RNA id: TU2685824


Basic Information

Item Value
RNA id TU2685824
length 407
lncRNA type intronic
GC content 0.36
exon number 2
gene id G2344527
representative True

Chromosome Information

Item Value
chromosome id NW_023493672.1
NCBI id JAAXML020000394.1
chromosome length 888553
location 206889 ~ 212987 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence

catgtgataggttagagttagatagactaggtcatgtgatatgttagagttagatagactaggtcatgtgatatgttagagttagatagactaggtcatgtgataggttagagttagataggctaggtcatgtgataggttagagttagatagactaggtcatgtgataggttagagctagatagactaggtcatgtgatatgttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgatatgttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgataggttagagttagatagactaggtcatgtgatatgttagagttagatagactaggtcatgtgataggttagaattagat

Function

GO: NA

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU2685820 lncRNA downstream 6682 200006 ~ 200207 (-) True G2344524
TU2685819 lncRNA downstream 8072 198543 ~ 198817 (-) True G2344523
TU2685779 lncRNA downstream 9497 187157 ~ 197392 (-) False LOC110519864
TU2685814 lncRNA downstream 24157 182421 ~ 182732 (-) True G2344518
TU2685812 lncRNA downstream 25333 181108 ~ 181556 (-) True G2344516
TU2685828 lncRNA upstream 760 213747 ~ 214013 (-) True G2344530
TU2685829 lncRNA upstream 1637 214624 ~ 214854 (-) True G2344531
TU2685831 lncRNA upstream 8868 221855 ~ 222118 (-) True G2344533
TU2685833 lncRNA upstream 16454 229441 ~ 229803 (-) True G2344535
TU2685781 lncRNA upstream 17051 230038 ~ 230466 (-) False LOC110519864
XM_036972589.1 mRNA downstream 165443 170 ~ 41446 (-) False LOC110534599
XM_036972590.1 mRNA downstream 171588 170 ~ 35301 (-) False LOC110534599
XM_036972588.1 mRNA upstream 481805 694792 ~ 819312 (-) False LOC110517917
TU2685800 other downstream 40780 165388 ~ 166109 (-) True G2344505
TU2685745 other downstream 137346 67053 ~ 69543 (-) True G2344464
TU2685546 other downstream 170494 31211 ~ 36395 (-) False LOC110534599
TU2686263 other upstream 527516 740503 ~ 747999 (-) True LOC110517917

Expression Profile

TU2685824 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU2685824 Expression in each Bioproject

Bar chart with 13 bars.
TU2685824 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.