RNA id: TU2706118



Basic Information


Item Value
RNA id TU2706118
length 267
lncRNA type intronic
GC content 0.41
exon number 3
gene id G2359041
representative False

Chromosome Information


Item Value
chromosome id NW_023493714.1
NCBI id JAAXML020000696.1
chromosome length 322154
location 220829 ~ 222806 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AGGGGACATGATAAATGACAGGTAGATAATAGCTAGCCCACTAGGAGACATGATAAATGACAGGTAGATAATAGCTAGCCCACTGGGAGACATGATAAATGACAGGTAGATGATAGCTAGCCCACTAGGAGACATGATAAATGACAGGTAGATAATAGCTAACCCACTAGGAGACATGATAAATGACAGGTAGATAATAGCTAGCCCACTAGGAGACATGATAAATGACAGGTAGATAATAGCTAGCCCACTAGGAGACATGATAAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2706107 lncRNA downstream 3815 216478 ~ 217014 (-) False LOC118948733
TU2706099 lncRNA downstream 10983 209413 ~ 209846 (-) True G2359032
TU2706093 lncRNA downstream 42777 176226 ~ 178052 (-) True G2359027
TU2706088 lncRNA downstream 54580 165876 ~ 166249 (-) True G2359024
TU2706089 lncRNA downstream 56369 163555 ~ 164460 (-) True G2359025
TU2706128 lncRNA upstream 27447 249833 ~ 250518 (-) True G2359044
TU2706136 lncRNA upstream 64137 286523 ~ 286821 (-) True G2359052
TU2706139 lncRNA upstream 65712 288098 ~ 299327 (-) True G2359055
XM_036973484.1 mRNA downstream 2174 216729 ~ 218655 (-) False LOC118948733
XR_005042206.1 mRNA downstream 2174 216729 ~ 218655 (-) False LOC118948733
XR_005042207.1 mRNA downstream 2174 216729 ~ 218655 (-) False LOC118948733
trnaa-ugc-289 mRNA downstream 97618 123137 ~ 123211 (-) False trnaa-ugc-289
XM_036973476.1 mRNA downstream 114631 99610 ~ 106198 (-) False LOC110522806
TU2706112 other downstream 2764 217422 ~ 218065 (-) True LOC118948733
TU2706129 other upstream 36922 259308 ~ 259778 (-) True G2359045

Expression Profile


TU2706118 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 75.
End of interactive chart.

TU2706118 Expression in each Bioproject

Bar chart with 12 bars.
TU2706118 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.