RNA id: TCONS_00060646


Basic Information

Item Value
RNA id TCONS_00060646
length 259
RNA type mRNA
GC content 0.47
exon number 5
gene id XLOC_031224
representative True

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 35123662 ~ 35201482 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAAATTCCACGTCCAGATCAAACCAGTGCAGACCAACAATGGCACACACCAGCACAAAGTCACAATCGATGAGCTGAAGGCCTCCATAGGAAACATCTCCCTCTCACCCACCCCTGCTGTTCATATGAAGAGGAACCAATCCAGAATGACACGACAGCACACTTTTCCTTCAATGAATCCAAAGTCAGATGATGAACTGGCACGACCCAAGATCCCACAGCCACCCTTAAATGATAGATTTTCCAGTAATGACCTGCTG

Function

GO:

id name namespace
GO:0072659 protein localization to plasma membrane biological_process
GO:0006897 endocytosis biological_process
GO:0048488 synaptic vesicle endocytosis biological_process
GO:0043009 chordate embryonic development biological_process
GO:0048268 clathrin coat assembly biological_process
GO:0072583 clathrin-dependent endocytosis biological_process
GO:0010324 membrane invagination biological_process
GO:0030136 clathrin-coated vesicle cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005886 plasma membrane cellular_component
GO:0005905 clathrin-coated pit cellular_component
GO:0016020 membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0001786 phosphatidylserine binding molecular_function
GO:0005546 phosphatidylinositol-4,5-bisphosphate binding molecular_function
GO:0008092 cytoskeletal protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-228 Predicted to enable phosphatidylinositol-4,5-bisphosphate binding activity and phosphatidylserine binding activity. Acts upstream of or within chordate embryonic development. Predicted to be located in membrane. Predicted to be active in clathrin-coated pit and clathrin-coated vesicle. Is expressed in anterior axial hypoblast; hatching gland; immature eye; polster; and yolk syncytial layer. Orthologous to human FCHO2 (FCH and mu domain containing endocytic adaptor 2).

Ensembl:

ensembl_id ENSDART00000144105

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00060610 lncRNA downstream 1857915 33284809 ~ 33287584 (-) False XLOC_031208
TCONS_00060607 lncRNA downstream 1857926 33284503 ~ 33287573 (-) False XLOC_031208
TCONS_00060609 lncRNA downstream 1857938 33284721 ~ 33287561 (-) False XLOC_031208
TCONS_00060599 lncRNA downstream 1871084 33269436 ~ 33274415 (-) False XLOC_031207
TCONS_00062041 lncRNA downstream 2217580 32922656 ~ 32927919 (-) True XLOC_031200
TCONS_00062042 lncRNA upstream 43187 35202566 ~ 35206296 (-) True XLOC_031225
TCONS_00060651 lncRNA upstream 364030 35523409 ~ 35540980 (-) False XLOC_031229
TCONS_00060652 lncRNA upstream 367378 35526757 ~ 35540895 (-) True XLOC_031229
TCONS_00060655 lncRNA upstream 566168 35725547 ~ 35728227 (-) True XLOC_031230
TCONS_00062043 lncRNA upstream 1662495 36821874 ~ 36829073 (-) True XLOC_031238
TCONS_00060642 mRNA downstream 8134 35123662 ~ 35137365 (-) False XLOC_031224
TCONS_00060641 mRNA downstream 36606 35105085 ~ 35108893 (-) True XLOC_031223
TCONS_00060640 mRNA downstream 147869 34987457 ~ 34997630 (-) True XLOC_031222
TCONS_00060639 mRNA downstream 152254 34987448 ~ 34993245 (-) False XLOC_031222
TCONS_00060638 mRNA downstream 152257 34987448 ~ 34993242 (-) False XLOC_031222
TCONS_00060647 mRNA upstream 42684 35202063 ~ 35252761 (-) False XLOC_031225
TCONS_00060648 mRNA upstream 94078 35253457 ~ 35264517 (-) True XLOC_031226
TCONS_00060649 mRNA upstream 111480 35270859 ~ 35301800 (-) True XLOC_031227
TCONS_00060650 mRNA upstream 262387 35421766 ~ 35456269 (-) True XLOC_031228
TCONS_00060653 mRNA upstream 523302 35682681 ~ 35743741 (-) False XLOC_031230
TCONS_00060637 other downstream 180712 34918991 ~ 34964787 (-) True XLOC_031220
TCONS_00060636 other downstream 311406 34833978 ~ 34834093 (-) True XLOC_031221
TCONS_00060631 other downstream 529533 34603814 ~ 34615966 (-) False XLOC_031219
TCONS_00060628 other downstream 907476 34237907 ~ 34238023 (-) True XLOC_031218
TCONS_00060627 other downstream 995377 34142593 ~ 34150122 (-) True XLOC_031217
TCONS_00060656 other upstream 664039 35823418 ~ 35823548 (-) True XLOC_031231
TCONS_00060682 other upstream 2107868 37267247 ~ 37268199 (-) True XLOC_031247
TCONS_00060692 other upstream 2731228 37890607 ~ 37894891 (-) False XLOC_031255
TCONS_00060699 other upstream 2789475 37948854 ~ 37963763 (-) False XLOC_031257
TCONS_00060700 other upstream 2793957 37953336 ~ 37959979 (-) True XLOC_031257

Expression Profile

//