RNA id: TCONS_00062471


Basic Information

Item Value
RNA id TCONS_00062471
length 300
RNA type mRNA
GC content 0.60
exon number 2
gene id XLOC_031904
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 12853655 ~ 12865827 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAACAATCAGCCAAGGCCTCTCCAGGAGATTCCTCCATATCTCTGCCCAGACAGAAACAAGGTGAACTTCATACCCAAAAGCGGCTCTGCCTTCTGCCTGGTGAGCATCCTGAAGCCTCTGCTCCCCACCCAAGAGCTGACCTTCCGCAGCGGGGTGAGCTACCGCAGCATCTCCCCCTCCCTGGTGCCTCTGACTGGGGTCGGAGTAAGGAGCCTGTCCCCCTCCATGGGCCCCGTCCTGTCCCGTGGACGTCAGTCACCATGCCTCCCACGACACCTTGAGGAGCCAGAGGGATAA

Function

GO: NA

KEGG: NA

ZFIN:

id description
ZDB-GENE-131127-569 Orthologous to human FAM117B (family with sequence similarity 117 member B).

Ensembl:

ensembl_id ENSDART00000090065

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00062447 lncRNA upstream 1466393 11397653 ~ 11398744 (+) True XLOC_031893
TCONS_00064819 lncRNA upstream 1856707 10988645 ~ 11008430 (+) False XLOC_031888
TCONS_00062435 lncRNA upstream 1856707 10988764 ~ 11008430 (+) True XLOC_031888
TCONS_00064607 lncRNA upstream 1934047 10930890 ~ 10931090 (+) True XLOC_031887
TCONS_00064818 lncRNA upstream 1974913 10889061 ~ 10890224 (+) True XLOC_031885
TCONS_00062477 lncRNA downstream 121388 12986853 ~ 12993502 (+) False XLOC_031907
TCONS_00062476 lncRNA downstream 121391 12986856 ~ 12990694 (+) True XLOC_031907
TCONS_00062479 lncRNA downstream 162399 13027864 ~ 13031519 (+) True XLOC_031908
TCONS_00062487 lncRNA downstream 252076 13117541 ~ 13123424 (+) False XLOC_031912
TCONS_00064820 lncRNA downstream 394617 13260082 ~ 13267143 (+) True XLOC_031915
TCONS_00062466 mRNA upstream 313778 12482599 ~ 12551359 (+) False XLOC_031903
TCONS_00062468 mRNA upstream 314496 12504462 ~ 12550641 (+) False XLOC_031903
TCONS_00062469 mRNA upstream 324623 12527725 ~ 12540514 (+) True XLOC_031903
TCONS_00062467 mRNA upstream 326014 12503849 ~ 12539123 (+) False XLOC_031903
TCONS_00062465 mRNA upstream 398587 12462079 ~ 12466550 (+) True XLOC_031902
TCONS_00062472 mRNA downstream 56537 12922002 ~ 12923727 (+) False XLOC_031905
TCONS_00062473 mRNA downstream 56653 12922118 ~ 12923344 (+) True XLOC_031905
TCONS_00062474 mRNA downstream 102636 12968101 ~ 12985390 (+) True XLOC_031906
TCONS_00062475 mRNA downstream 121388 12986853 ~ 12993499 (+) False XLOC_031907
TCONS_00062478 mRNA downstream 158983 13024448 ~ 13037815 (+) False XLOC_031908
TCONS_00062453 other upstream 1090405 11774617 ~ 11774732 (+) True XLOC_031897
TCONS_00062446 other upstream 1457000 11397641 ~ 11408137 (+) False XLOC_031893
TCONS_00062436 other upstream 1846605 11018416 ~ 11018532 (+) True XLOC_031889
TCONS_00062432 other upstream 1997996 10867024 ~ 10867141 (+) True XLOC_031883
TCONS_00062404 other upstream 2956375 9901124 ~ 9908762 (+) False XLOC_031864
TCONS_00062481 other downstream 174525 13039990 ~ 13045501 (+) True XLOC_031909
TCONS_00062509 other downstream 1115480 13980945 ~ 13981092 (+) True XLOC_031925
TCONS_00062521 other downstream 2678590 15544055 ~ 15544170 (+) True XLOC_031935
TCONS_00062540 other downstream 4185574 17051039 ~ 17051135 (+) True XLOC_031953
TCONS_00062544 other downstream 4339727 17205192 ~ 17205289 (+) True XLOC_031958

Expression Profile

//