RNA id: TCONS_00062923


Basic Information

Item Value
RNA id TCONS_00062923
length 384
RNA type mRNA
GC content 0.39
exon number 3
gene id XLOC_032208
representative False

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 39532478 ~ 39541448 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTTTTTCTTATATTCTACAAATATACAGGACATTGAAGGAGATGGCATCCAGAGAGACCTGCAGAATTCCACCATGGGCGTATATGTCATCAACAAGGAGGGTGGAGAAATTGGAGCACATGATGACATTTATGTTGAAGGAGAAATCATTCTGGACAACATTGGATCTGTAGCCCAAGCATCTGCAATGATGCTGGGAGTCATCTATGTATTGAACTTGGCCTACCCCAAAGAGCTGAAATACTCTTATGAATTCATTCAAAATGTGCTCTTGAAAATGGATGGAGAAAGACTTTCCCCCAAAGTCCTTGGACTAAAGAACAAAATCATTGATTTCTTCAGCCTGTATAAAACAAGTTTATATTCTCCACTCGTTTTTTAA

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0022402 cell cycle process biological_process
GO:0098813 nuclear chromosome segregation biological_process
GO:0006310 DNA recombination biological_process
GO:0022607 cellular component assembly biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0000819 sister chromatid segregation biological_process
GO:0009838 abscission biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0045132 meiotic chromosome segregation biological_process
GO:0000075 cell cycle checkpoint biological_process
GO:0061982 meiosis I cell cycle process biological_process
GO:0035825 homologous recombination biological_process
GO:0045786 negative regulation of cell cycle biological_process
GO:0140013 meiotic nuclear division biological_process
GO:0140014 mitotic nuclear division biological_process
GO:0090068 positive regulation of cell cycle process biological_process
GO:0006996 organelle organization biological_process
GO:0044770 cell cycle phase transition biological_process
GO:0051783 regulation of nuclear division biological_process
GO:0048285 organelle fission biological_process
GO:0007049 cell cycle biological_process
GO:0007346 regulation of mitotic cell cycle biological_process
GO:0051276 chromosome organization biological_process
GO:0007059 chromosome segregation biological_process
GO:0051304 chromosome separation biological_process
GO:0007093 mitotic cell cycle checkpoint biological_process
GO:0051321 meiotic cell cycle biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0044878 mitotic cytokinesis checkpoint biological_process
GO:0045930 negative regulation of mitotic cell cycle biological_process
GO:1903046 meiotic cell cycle process biological_process
GO:1903047 mitotic cell cycle process biological_process
GO:0007127 meiosis I biological_process
GO:0007131 reciprocal meiotic recombination biological_process
GO:0010564 regulation of cell cycle process biological_process
GO:0051641 cellular localization biological_process
GO:1901987 regulation of cell cycle phase transition biological_process
GO:1901990 regulation of mitotic cell cycle phase transition biological_process
GO:0000278 mitotic cell cycle biological_process
GO:0016043 cellular component organization biological_process
GO:0000280 nuclear division biological_process
GO:0044424 obsolete intracellular part cellular_component
GO:0044451 obsolete nucleoplasm part cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0043226 organelle cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000185742

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00062917 lncRNA upstream 157862 39370335 ~ 39378734 (+) False XLOC_032204
TCONS_00064906 lncRNA upstream 581470 38953481 ~ 38955126 (+) True XLOC_032194
TCONS_00062900 lncRNA upstream 651058 38880442 ~ 38885538 (+) True XLOC_032192
TCONS_00062888 lncRNA upstream 946424 38518219 ~ 38590172 (+) True XLOC_032188
TCONS_00064905 lncRNA upstream 1176153 38358681 ~ 38360443 (+) True XLOC_032185
TCONS_00062924 lncRNA downstream 124899 39666347 ~ 39667572 (+) True XLOC_032209
TCONS_00062925 lncRNA downstream 158752 39700200 ~ 39717558 (+) True XLOC_032210
TCONS_00064912 lncRNA downstream 333076 39874524 ~ 39882227 (+) True XLOC_032213
TCONS_00064913 lncRNA downstream 463147 40004595 ~ 40017137 (+) True XLOC_032216
TCONS_00062939 lncRNA downstream 907186 40448634 ~ 40451840 (+) True XLOC_032220
TCONS_00062922 mRNA upstream 28221 39506043 ~ 39508375 (+) True XLOC_032207
TCONS_00062921 mRNA upstream 33215 39499623 ~ 39503381 (+) True XLOC_032206
TCONS_00062920 mRNA upstream 38622 39493864 ~ 39497974 (+) True XLOC_032205
TCONS_00062918 mRNA upstream 161074 39370615 ~ 39375522 (+) False XLOC_032204
TCONS_00062915 mRNA upstream 171129 39360377 ~ 39365467 (+) False XLOC_032203
TCONS_00062926 mRNA downstream 271027 39812475 ~ 39831089 (+) True XLOC_032211
TCONS_00062927 mRNA downstream 295026 39836474 ~ 39866670 (+) True XLOC_032212
TCONS_00062928 mRNA downstream 363573 39905021 ~ 39912440 (+) True XLOC_032214
TCONS_00062929 mRNA downstream 381604 39923052 ~ 39991554 (+) False XLOC_032215
TCONS_00062933 mRNA downstream 389377 39930825 ~ 39990998 (+) False XLOC_032215
TCONS_00062919 other upstream 164721 39370620 ~ 39371875 (+) True XLOC_032204
TCONS_00062894 other upstream 678294 38845676 ~ 38858302 (+) False XLOC_032191
TCONS_00062893 other upstream 754438 38773418 ~ 38782158 (+) True XLOC_032190
TCONS_00062884 other upstream 1159385 38377091 ~ 38377211 (+) True XLOC_032186
TCONS_00062883 other upstream 1448985 38087495 ~ 38087611 (+) True XLOC_032184
TCONS_00062936 other downstream 502167 40043615 ~ 40049445 (+) True XLOC_032217
TCONS_00062945 other downstream 1004417 40545865 ~ 40546975 (+) False XLOC_032225
TCONS_00062987 other downstream 1653239 41194687 ~ 41194801 (+) True XLOC_032251
TCONS_00062995 other downstream 1913343 41454791 ~ 41454873 (+) True XLOC_032256
TCONS_00062996 other downstream 1922337 41463785 ~ 41493470 (+) False XLOC_032257