RNA id: TCONS_00062999


Basic Information

Item Value
RNA id TCONS_00062999
length 497
RNA type mRNA
GC content 0.52
exon number 2
gene id XLOC_032258
representative False

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 41503854 ~ 41506749 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCATCGATTCTGTGGCTTTCGCGGAGGCGCGCTGCCGATGTCGTCACAGGCGCTAAACACGGGGAGATTCTCAGAAAAGCAATCCCGAGAAGTCAGACAAACTGAACAAGGCAAACCCTGCAGTGCTCAGCCTGTCGTTCAGTTTTAGGGCACGAGCTAAACAGAAACGCCGCTCGTTTTCGAGAAGCATGTCCGCGTTATCAACTCGAGCAGTTTGTTAAACAAATTGGCGGACGGGTCGCGCGCACTTGTGTGACAGCCAGAGACAGAAGTACTGACTGAGTGTCCGGACGCTCCTCACCGCCGCCGAGATCCGCTGATTTTTACAAGCCCGAGAGGGAAATCTCAGCATCAAAGAAACTTTAAGGAATCCGGCTGATTTCAAACCGGACATCTTCATTATGATATTGTGCGTTGAAGGCCCGAGAGCTCTTTTGCCTTTCTCTTCACCGAGACGCATTGACGAACCTTTTCTCACCATTGAGGACGCTAGCAA

Function

GO:

id name namespace
GO:0046854 phosphatidylinositol phosphorylation biological_process
GO:0035556 intracellular signal transduction biological_process
GO:1903707 negative regulation of hemopoiesis biological_process
GO:0016567 protein ubiquitination biological_process
GO:0045620 negative regulation of lymphocyte differentiation biological_process
GO:0046426 negative regulation of receptor signaling pathway via JAK-STAT biological_process
GO:0045638 negative regulation of myeloid cell differentiation biological_process
GO:0045647 negative regulation of erythrocyte differentiation biological_process
GO:0005942 phosphatidylinositol 3-kinase complex cellular_component
GO:0046935 1-phosphatidylinositol-3-kinase regulator activity molecular_function

KEGG:

id description
ko04630 JAK-STAT signaling pathway
ko04917 Prolactin signaling pathway
ko04121 Ubiquitin system

ZFIN:

id description
ZDB-GENE-050907-1 Predicted to enable 1-phosphatidylinositol-3-kinase regulator activity. Acts upstream of or within negative regulation of erythrocyte differentiation; negative regulation of lymphocyte differentiation; and negative regulation of receptor signaling pathway via JAK-STAT. Predicted to be part of phosphatidylinositol 3-kinase complex. Is expressed in blastomere; pronephric duct; thymus; and ventral wall of dorsal aorta. Human ortholog(s) of this gene implicated in malaria and tuberculosis. Orthologous to human CISH (cytokine inducible SH2 containing protein).

Ensembl:

ensembl_id ENSDART00000140108

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00062980 lncRNA upstream 401667 41096173 ~ 41102304 (+) False XLOC_032246
TCONS_00064922 lncRNA upstream 420986 41080510 ~ 41082985 (+) True XLOC_032245
TCONS_00064921 lncRNA upstream 517836 40984597 ~ 40986135 (+) True XLOC_032242
TCONS_00062966 lncRNA upstream 663070 40837650 ~ 40840901 (+) True XLOC_032238
TCONS_00062958 lncRNA upstream 839654 40662533 ~ 40664317 (+) True XLOC_032232
TCONS_00063004 lncRNA downstream 128830 41634069 ~ 41648856 (+) False XLOC_032259
TCONS_00063005 lncRNA downstream 128940 41634179 ~ 41670341 (+) False XLOC_032259
TCONS_00063006 lncRNA downstream 185855 41691094 ~ 41710148 (+) True XLOC_032259
TCONS_00064923 lncRNA downstream 260399 41765638 ~ 41773554 (+) False XLOC_032260
TCONS_00064925 lncRNA downstream 260447 41765686 ~ 41773554 (+) False XLOC_032260
TCONS_00062997 mRNA upstream 2205 41463786 ~ 41501766 (+) True XLOC_032257
TCONS_00062994 mRNA upstream 42581 41452979 ~ 41461390 (+) True XLOC_032255
TCONS_00062991 mRNA upstream 52127 41446541 ~ 41451844 (+) False XLOC_032254
TCONS_00063002 mRNA downstream 49555 41554794 ~ 41755753 (+) False XLOC_032259
TCONS_00063003 mRNA downstream 50008 41555247 ~ 41757181 (+) False XLOC_032259
TCONS_00063007 mRNA downstream 303434 41808673 ~ 41887398 (+) False XLOC_032262
TCONS_00063011 mRNA downstream 451116 41956355 ~ 41974205 (+) False XLOC_032264
TCONS_00063012 mRNA downstream 452041 41957280 ~ 41974205 (+) True XLOC_032264
TCONS_00062996 other upstream 10501 41463785 ~ 41493470 (+) False XLOC_032257
TCONS_00062995 other upstream 49098 41454791 ~ 41454873 (+) True XLOC_032256
TCONS_00062987 other upstream 309170 41194687 ~ 41194801 (+) True XLOC_032251
TCONS_00062945 other upstream 956996 40545865 ~ 40546975 (+) False XLOC_032225
TCONS_00062936 other upstream 1454526 40043615 ~ 40049445 (+) True XLOC_032217
TCONS_00063008 other downstream 348133 41853372 ~ 41869189 (+) True XLOC_032262
TCONS_00063013 other downstream 492724 41997963 ~ 41998096 (+) True XLOC_032265
TCONS_00063014 other downstream 657411 42162650 ~ 42162774 (+) True XLOC_032266
TCONS_00063021 other downstream 1113663 42618902 ~ 42622652 (+) True XLOC_032272
TCONS_00063022 other downstream 1130721 42635960 ~ 42643033 (+) True XLOC_032273

Expression Profile

//