RNA id: TCONS_00063012


Basic Information

Item Value
RNA id TCONS_00063012
length 1167
RNA type mRNA
GC content 0.49
exon number 2
gene id XLOC_032264
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 41956355 ~ 41974205 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGAGGACATCTTCAAGGATCAAGACTTTTGGTCCTTTAATGAGTCATCCAGAAACGCCACCAATGAAACCTACGGCGTGAACCAGACGGTGAATCCCCTCAAGCGGAACGAAGAGGTGGCCAAAGTGGAAGTTACCGTGTTGGCCTTGGTGCTGTTCTTGGCGCTCGCCGGTAACCTTTGCGTCCTTATTGCAATCCACACAGCCAAGCACAGCCAGTCTCGCATGTATTACTTCATGAAGCACCTCAGCATTGCAGACCTGGTCGTGGCCGTCTTCCAGGTTCTTCCTCAACTCATTTGGGACATCACTTTTCGCTTTTATGGTCCGGACATCTTGTGTAGGTTGGTGAAGTATCTTCAGACTGTTGGGATGTTCGCCTCCACCTACATGCTGGTGCTGATGTCCATAGACAGATGCATGGCGATCTGCCAACCTCTTCGTTCTTTACACAAGAGAAAGGACCGCTGTTACGTGATTTGTTCATGGGCACTGAGCTTACTTTTCAGCATCCCGCAGGTTTATATCTTCTCCCTACGGGAGGTGGGTTCAGGAGTCTATGATTGCTGGGGAGATTTTGTTCAGCCTTGGGGAGCGAAAGCCTACATTACGTGGATTAGTCTGACAATATACATTATACCAGTGACCATTCTGAGTGTCTGCTACGGGCTGATAAGCTTTAAAATATGGCAAAACTTTAAAAGGAAGACGAAGAGGGACCAGTGCATCACTCTCACACCCAAAGCATCCAAAGGCAACGCGCTCGCGCGGGTCAGCAGCGTCAAACTCATTTCCAAGGCCAAAATCACCACCGTTAAAATGACTTTTGTTATCGTACTGGCTTACATAGTGTGTTGGACTCCGTTTTTCTCCGTGCAGATGTGGTCAGCATGGGATCCTGAAGCACCGAGGGAAGCGATGCCCTTTATCATCTCCATGTTGCTGGCCAGTCTGAACAGCTGCTGCAACCCCTGGATCTACATGTTTTTTGCTGGCCATCTCTTCCATGACCTGAAGCAGAATCTGTTTTGCTGCTCCACGCTCTATCTGAAGTCCTCTCAATGCCGCTATGATCCAGAGCAAGATTCCCGTAAGAGCAACTCCTCCACCTACGTCATCAAAAGCACCAGCAGCCAGCGGAGCATCACCCAAACCTCCATCACATAA

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0001992 regulation of systemic arterial blood pressure by vasopressin biological_process
GO:0045766 positive regulation of angiogenesis biological_process
GO:0060137 maternal process involved in parturition biological_process
GO:0048848 neurohypophysis morphogenesis biological_process
GO:0045907 positive regulation of vasoconstriction biological_process
GO:0007165 signal transduction biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0042277 peptide binding molecular_function
GO:0004990 oxytocin receptor activity molecular_function
GO:0005000 vasopressin receptor activity molecular_function

KEGG:

id description
ko04020 Calcium signaling pathway
ko04024 cAMP signaling pathway
ko04080 Neuroactive ligand-receptor interaction
ko04921 Oxytocin signaling pathway
ko04030 G protein-coupled receptors

ZFIN:

id description
ZDB-GENE-110805-2 Enables peptide hormone binding activity. Acts upstream of or within neurohypophysis morphogenesis and positive regulation of angiogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in several structures, including eye; heart; integument; liver; and pleuroperitoneal region. Orthologous to human OXTR (oxytocin receptor).

Ensembl:

ensembl_id ENSDART00000050114

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00063010 lncRNA upstream 42267 41909373 ~ 41915013 (+) True XLOC_032263
TCONS_00063009 lncRNA upstream 46810 41909373 ~ 41910470 (+) False XLOC_032263
TCONS_00064680 lncRNA upstream 46873 41896384 ~ 41910407 (+) False XLOC_032263
TCONS_00064927 lncRNA upstream 168866 41779149 ~ 41788414 (+) False XLOC_032261
TCONS_00063016 lncRNA downstream 408989 42383194 ~ 42383446 (+) True XLOC_032268
TCONS_00063020 lncRNA downstream 630036 42604241 ~ 42610935 (+) False XLOC_032271
TCONS_00064929 lncRNA downstream 634337 42608542 ~ 42610935 (+) True XLOC_032271
TCONS_00064931 lncRNA downstream 682508 42656713 ~ 42666008 (+) False XLOC_032275
TCONS_00064930 lncRNA downstream 682508 42656713 ~ 42666008 (+) False XLOC_032275
TCONS_00063007 mRNA upstream 69882 41808673 ~ 41887398 (+) False XLOC_032262
TCONS_00063003 mRNA upstream 200099 41555247 ~ 41757181 (+) False XLOC_032259
TCONS_00063002 mRNA upstream 201527 41554794 ~ 41755753 (+) False XLOC_032259
TCONS_00063000 mRNA upstream 450531 41504120 ~ 41506749 (+) False XLOC_032258
TCONS_00062999 mRNA upstream 452041 41503971 ~ 41505239 (+) False XLOC_032258
TCONS_00063015 mRNA downstream 364104 42338309 ~ 42341219 (+) True XLOC_032267
TCONS_00063017 mRNA downstream 501525 42475730 ~ 42505007 (+) True XLOC_032269
TCONS_00063018 mRNA downstream 571592 42545797 ~ 42598011 (+) False XLOC_032270
TCONS_00063019 mRNA downstream 613432 42587637 ~ 42598328 (+) True XLOC_032270
TCONS_00063026 mRNA downstream 692489 42666694 ~ 42690736 (+) False XLOC_032276
TCONS_00063008 other upstream 88091 41853372 ~ 41869189 (+) True XLOC_032262
TCONS_00062996 other upstream 463810 41463785 ~ 41493470 (+) False XLOC_032257
TCONS_00062995 other upstream 502407 41454791 ~ 41454873 (+) True XLOC_032256
TCONS_00062987 other upstream 762479 41194687 ~ 41194801 (+) True XLOC_032251
TCONS_00062945 other upstream 1410305 40545865 ~ 40546975 (+) False XLOC_032225
TCONS_00063013 other downstream 23758 41997963 ~ 41998096 (+) True XLOC_032265
TCONS_00063014 other downstream 188445 42162650 ~ 42162774 (+) True XLOC_032266
TCONS_00063021 other downstream 644697 42618902 ~ 42622652 (+) True XLOC_032272
TCONS_00063022 other downstream 661755 42635960 ~ 42643033 (+) True XLOC_032273
TCONS_00063023 other downstream 672206 42646411 ~ 42653425 (+) True XLOC_032274

Expression Profile

//