RNA id: TCONS_00063053


Basic Information

Item Value
RNA id TCONS_00063053
length 358
RNA type mRNA
GC content 0.53
exon number 4
gene id XLOC_032294
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 44812444 ~ 44977428 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCAGACATTCTGCTGTCGCGCGCTGACTAACAGCTCCAGCTCTTCCCGCAAAAAACTCCTGTGAAAGGTAGCGAGACCACAGCCTGGGTTGGAGTGAGATGCACTGACTCCTGGCAGACTGCAGATTTCCCTGTCATCCTCCGCTCTCGCCTCTGAAACTGTGGCCAGTCATGCGGTTGTTACGGAAAACCCTGCTTCTTTTGGCTGCTTGCCTTAATATGAGCAGCAGGTATCAAACTAACGCCCTGGAAATTCCACTTGATGTTTTAGAGCGCATGAACATGGAGCAGCTGCCCACAATTACAGAGTACTCTCCTGCCTCGCTCATCGCCTTCCCTTTCGAAGAGAGCTTCCCTGT

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-091105-1 Predicted to be located in membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in schizophrenia. Orthologous to human CHL1 (cell adhesion molecule L1 like).

Ensembl:

ensembl_id ENSDART00000169713

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00064947 lncRNA upstream 7215 44400764 ~ 44805588 (+) False XLOC_032292
TCONS_00064681 lncRNA upstream 15244 44721192 ~ 44797559 (+) True XLOC_032293
TCONS_00064945 lncRNA upstream 92299 44400642 ~ 44720504 (+) False XLOC_032292
TCONS_00064946 lncRNA upstream 92299 44400747 ~ 44720504 (+) False XLOC_032292
TCONS_00064948 lncRNA upstream 92299 44486080 ~ 44720504 (+) True XLOC_032292
TCONS_00064682 lncRNA downstream 68173 44987628 ~ 45016837 (+) False XLOC_032295
TCONS_00064949 lncRNA downstream 68173 44987628 ~ 45083289 (+) False XLOC_032295
TCONS_00064950 lncRNA downstream 68228 44987683 ~ 45083289 (+) True XLOC_032295
TCONS_00063063 lncRNA downstream 999526 45918981 ~ 45922790 (+) False XLOC_032301
TCONS_00063068 lncRNA downstream 1015312 45934767 ~ 45936653 (+) True XLOC_032303
TCONS_00063046 mRNA upstream 603413 44197099 ~ 44209390 (+) False XLOC_032291
TCONS_00063047 mRNA upstream 605132 44197348 ~ 44207671 (+) True XLOC_032291
TCONS_00063045 mRNA upstream 619063 44163727 ~ 44193740 (+) True XLOC_032290
TCONS_00063043 mRNA upstream 905482 43903209 ~ 43907321 (+) True XLOC_032288
TCONS_00063041 mRNA upstream 1338046 43450221 ~ 43474757 (+) True XLOC_032285
TCONS_00063054 mRNA downstream 195158 45114613 ~ 45327481 (+) False XLOC_032296
TCONS_00063055 mRNA downstream 195219 45114674 ~ 45328699 (+) False XLOC_032296
TCONS_00063056 mRNA downstream 381291 45300746 ~ 45328910 (+) True XLOC_032296
TCONS_00063057 mRNA downstream 427353 45346808 ~ 45376758 (+) False XLOC_032297
TCONS_00063058 mRNA downstream 427764 45347219 ~ 45376758 (+) True XLOC_032297
TCONS_00063044 other upstream 679721 44132968 ~ 44133082 (+) True XLOC_032289
TCONS_00063042 other upstream 1310524 43499071 ~ 43502279 (+) True XLOC_032286
TCONS_00063027 other upstream 2132193 42674613 ~ 42680610 (+) True XLOC_032276
TCONS_00063023 other upstream 2159378 42646411 ~ 42653425 (+) True XLOC_032274
TCONS_00063022 other upstream 2169770 42635960 ~ 42643033 (+) True XLOC_032273
TCONS_00063059 other downstream 435954 45355409 ~ 45355525 (+) True XLOC_032298
TCONS_00063061 other downstream 685825 45605280 ~ 45605396 (+) True XLOC_032300
TCONS_00063065 other downstream 1012786 45932241 ~ 45933222 (+) False XLOC_032302
TCONS_00063069 other downstream 1106391 46025846 ~ 46025963 (+) True XLOC_032304
TCONS_00063090 other downstream 1830051 46749506 ~ 46749624 (+) True XLOC_032314

Expression Profile

//