RNA id: TCONS_00065148


Basic Information

Item Value
RNA id TCONS_00065148
length 358
lncRNA type sense_over
GC content 0.47
exon number 2
gene id XLOC_032835
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 21633286 ~ 21678263 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGAAGTGTGCGTCGGTCGACTGATGTTGAGCAGTTTGTTGAGAAGCAAAAATATAAACTGGCATCGGAACAATTAATAAATCAGGTGGGATTGTTGGAAGAGTGGATAGGTGATGGCATCTCACACAAACGACGAGAACAAACGAAAAATCACTTGAGAATAAAATAAGTGGAGAACAAACGCTGACATCTGTGCGGCGATTGCTCCCCCACCCACCAACCCCCACAATGTATGAACTACTTCAACAGCTCACGGAGGTTAGCATTTGCCAGCAACAAATAGCTGAACACCTCGTATCCCGACAAGATCAAACTGAGCAGGAGCTCGTGGCACTGCGAACCGCCACTACACAATGTGT

Function

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0034765 regulation of ion transmembrane transport biological_process
GO:0051260 protein homooligomerization biological_process
GO:0055085 transmembrane transport biological_process
GO:0006811 ion transport biological_process
GO:0006813 potassium ion transport biological_process
GO:1902259 regulation of delayed rectifier potassium channel activity biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008076 voltage-gated potassium channel complex cellular_component
GO:0005216 ion channel activity molecular_function
GO:0005244 voltage-gated ion channel activity molecular_function
GO:0005249 voltage-gated potassium channel activity molecular_function
GO:0005251 delayed rectifier potassium channel activity molecular_function
GO:0005267 potassium channel activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00064737 lncRNA downstream 72574 21589412 ~ 21597616 (-) True XLOC_032834
TCONS_00064736 lncRNA downstream 87552 21577860 ~ 21582638 (-) True XLOC_032833
TCONS_00064735 lncRNA downstream 135958 21532305 ~ 21534232 (-) True XLOC_032832
TCONS_00065147 lncRNA downstream 161151 21506893 ~ 21509039 (-) True XLOC_032830
TCONS_00064734 lncRNA downstream 161312 21504503 ~ 21508878 (-) False XLOC_032830
TCONS_00064738 lncRNA upstream 503052 22181262 ~ 22181876 (-) True XLOC_032842
TCONS_00064739 lncRNA upstream 688412 22366622 ~ 22369086 (-) True XLOC_032843
TCONS_00064740 lncRNA upstream 1339843 23018053 ~ 23018480 (-) True XLOC_032846
TCONS_00064741 lncRNA upstream 1429393 23107603 ~ 23117348 (-) True XLOC_032847
TCONS_00064742 lncRNA upstream 1532341 23210551 ~ 23214286 (-) False XLOC_032848
TCONS_00063837 mRNA downstream 53531 21588205 ~ 21616659 (-) False XLOC_032834
TCONS_00063836 mRNA downstream 87746 21576164 ~ 21582444 (-) False XLOC_032833
TCONS_00063835 mRNA downstream 135889 21525543 ~ 21534301 (-) False XLOC_032832
TCONS_00063834 mRNA downstream 148435 21513363 ~ 21521755 (-) True XLOC_032831
TCONS_00063833 mRNA downstream 177438 21470261 ~ 21492752 (-) False XLOC_032828
TCONS_00063839 mRNA upstream 18918 21697128 ~ 21726758 (-) True XLOC_032836
TCONS_00063840 mRNA upstream 131423 21809633 ~ 21830405 (-) False XLOC_032837
TCONS_00063841 mRNA upstream 131423 21809633 ~ 21830477 (-) True XLOC_032837
TCONS_00063844 mRNA upstream 182877 21861087 ~ 21873266 (-) False XLOC_032838
TCONS_00063843 mRNA upstream 182877 21861087 ~ 21873266 (-) False XLOC_032838
TCONS_00063825 other downstream 1022857 20647227 ~ 20647333 (-) True XLOC_032820
TCONS_00063824 other downstream 1205691 20464402 ~ 20464499 (-) True XLOC_032814
TCONS_00063823 other downstream 1260536 20409557 ~ 20409654 (-) True XLOC_032810
TCONS_00063822 other downstream 1332949 20337144 ~ 20337241 (-) True XLOC_032806
TCONS_00063821 other downstream 1370542 20299551 ~ 20299648 (-) True XLOC_032803
TCONS_00063850 other upstream 862772 22540982 ~ 22541076 (-) True XLOC_032844
TCONS_00063855 other upstream 1716633 23394843 ~ 23394899 (-) True XLOC_032849
TCONS_00063859 other upstream 2277164 23955374 ~ 24053616 (-) False XLOC_032853
TCONS_00063876 other upstream 3107617 24785827 ~ 24785943 (-) True XLOC_032864
TCONS_00063877 other upstream 3163960 24842170 ~ 24842286 (-) True XLOC_032865