RNA id: TCONS_00064738


Basic Information

Item Value
RNA id TCONS_00064738
length 615
lncRNA type inter_gene
GC content 0.52
exon number 1
gene id XLOC_032842
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 22181262 ~ 22181876 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTTAGTAGCAACTGCACCTCCTAATAGAAAGGCTCGCCAGGCAATCCGGGACACTTGGGGTGGGGAAGTGCACGTCAGAGGTCACCGGGTCATGACCCTCTTCGTTGTAGGTCAACCAACAGACCCGGTTATTGGAAAAGAACTAATCGAAGAGTCTTTAAAAGAGACGAGAGCGAACTTCTTGAGCTTTATTTAGGTCGTGTTCATATGCAGGTCGCACCCGATCGCAATCCCGCCAGCAGACACTTCATGTCGGAGACTGCATACGCTGGGATGGTCCTCCCGGATTACTGCAGTGGGACGGCGTATGTGCTTTCTCACTCAGCTTTGCTAAAGCTGTCCCTAGCTGCGGTTGCCATAAATCTACCCAAACCTTTGCCCCCGGAGGATGTGTTTGTAGAGATTTGTGCTCACACCGCAGGAATCAATCCAACCCATTCTCCATTCTTCTCTGGAGGACCGGCCGTACCGTACAGCCGCTGCTGCTACCAGACGATGGTGTCCGTCCATCATACCACACCAGCTAATATGTTAAACTACTGGACGGACATGCACTCCTCCGGCCCGTGCTCATGGTTGGGTGTGCGGACGTCTTTAGGTGTCTGTAAAGTAAGA

Function

GO:

id name namespace
GO:0007267 cell-cell signaling biological_process
GO:0001505 regulation of neurotransmitter levels biological_process
GO:0043252 sodium-independent organic anion transport biological_process
GO:0098563 intrinsic component of synaptic vesicle membrane cellular_component
GO:0044456 obsolete synapse part cellular_component
GO:0045202 synapse cellular_component
GO:0030285 integral component of synaptic vesicle membrane cellular_component
GO:0098793 presynapse cellular_component
GO:0015347 sodium-independent organic anion transmembrane transporter activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00065148 lncRNA downstream 503052 21670190 ~ 21678210 (-) True XLOC_032835
TCONS_00064737 lncRNA downstream 583646 21589412 ~ 21597616 (-) True XLOC_032834
TCONS_00064736 lncRNA downstream 598624 21577860 ~ 21582638 (-) True XLOC_032833
TCONS_00064735 lncRNA downstream 647030 21532305 ~ 21534232 (-) True XLOC_032832
TCONS_00065147 lncRNA downstream 672223 21506893 ~ 21509039 (-) True XLOC_032830
TCONS_00064739 lncRNA upstream 184746 22366622 ~ 22369086 (-) True XLOC_032843
TCONS_00064740 lncRNA upstream 836177 23018053 ~ 23018480 (-) True XLOC_032846
TCONS_00064741 lncRNA upstream 925727 23107603 ~ 23117348 (-) True XLOC_032847
TCONS_00064742 lncRNA upstream 1028675 23210551 ~ 23214286 (-) False XLOC_032848
TCONS_00065149 lncRNA upstream 1028675 23210551 ~ 23214794 (-) True XLOC_032848
TCONS_00063848 mRNA downstream 35004 22119189 ~ 22146258 (-) True XLOC_032841
TCONS_00063847 mRNA downstream 117104 22043127 ~ 22064158 (-) True XLOC_032840
TCONS_00063846 mRNA downstream 192887 21874932 ~ 21988375 (-) True XLOC_032839
TCONS_00063845 mRNA downstream 219445 21874932 ~ 21961817 (-) False XLOC_032839
TCONS_00063844 mRNA downstream 307996 21861087 ~ 21873266 (-) False XLOC_032838
TCONS_00063849 mRNA upstream 170347 22352223 ~ 22369125 (-) False XLOC_032843
TCONS_00063852 mRNA upstream 775833 22957709 ~ 23002373 (-) False XLOC_032845
TCONS_00063851 mRNA upstream 775833 22957709 ~ 23002373 (-) True XLOC_032845
TCONS_00063854 mRNA upstream 925726 23107602 ~ 23117348 (-) False XLOC_032847
TCONS_00063853 mRNA upstream 925726 23107602 ~ 23117348 (-) False XLOC_032847
TCONS_00063825 other downstream 1533929 20647227 ~ 20647333 (-) True XLOC_032820
TCONS_00063824 other downstream 1716763 20464402 ~ 20464499 (-) True XLOC_032814
TCONS_00063823 other downstream 1771608 20409557 ~ 20409654 (-) True XLOC_032810
TCONS_00063822 other downstream 1844021 20337144 ~ 20337241 (-) True XLOC_032806
TCONS_00063821 other downstream 1881614 20299551 ~ 20299648 (-) True XLOC_032803
TCONS_00063850 other upstream 359106 22540982 ~ 22541076 (-) True XLOC_032844
TCONS_00063855 other upstream 1212967 23394843 ~ 23394899 (-) True XLOC_032849
TCONS_00063859 other upstream 1773498 23955374 ~ 24053616 (-) False XLOC_032853
TCONS_00063876 other upstream 2603951 24785827 ~ 24785943 (-) True XLOC_032864
TCONS_00063877 other upstream 2660294 24842170 ~ 24842286 (-) True XLOC_032865

Expression Profile

//