RNA id: TCONS_00064084


Basic Information

Item Value
RNA id TCONS_00064084
length 534
RNA type mRNA
GC content 0.44
exon number 4
gene id XLOC_032977
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 35459369 ~ 35488180 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTCAGGGCCATGAAAACTAGACTAGGGTGCCTGTCTAACAAGTCAGACTCATGCAGCGATTTTTCCGAATTCCTGCCTCCAGCTCAGGAGAGAACCACAAGATACCTGAAATTGTCCAATGATGAAGTGACCAGATGGGCAGACTCTTTCGATATTCTCCTGTCCAATAAATATGGTCTGGCTGCCTTCAGAACCTTCCTGAAAACAGAGTTCAGTGATGAAAACATTGAGTTCTGGTTGGCCTGTGAGGACTATAAAAAGATCAAATCCCCTGCTAAGATGATGTCCAAGGCCAATAAGATCTACAAGGAATTTATTGACGTTCATGCACCCAGAGAGGTCAACATAGACCACAGGACCAGAGAGGAAACCAAAAACAGGCTTCTAGAACCGACTCCACACAGTCTCAACGAAGTGCAAGCTAAAGTGTACAGCCTGATGGAGAAGGACTCGTATCCTCGGTTTATAAGATCAAAGATCTATCAGGACTTACTGAACAGGACACAGATTTACTGTCAGAGGAAGTCTGTTTAA

Function

GO:

id name namespace
GO:0007213 G protein-coupled acetylcholine receptor signaling pathway biological_process
GO:0060159 regulation of dopamine receptor signaling pathway biological_process
GO:0009968 negative regulation of signal transduction biological_process
GO:0031234 extrinsic component of cytoplasmic side of plasma membrane cellular_component
GO:0042995 cell projection cellular_component
GO:0030425 dendrite cellular_component
GO:0005886 plasma membrane cellular_component
GO:0005634 nucleus cellular_component
GO:0043204 perikaryon cellular_component
GO:0016020 membrane cellular_component
GO:0032809 neuronal cell body membrane cellular_component
GO:0005096 GTPase activator activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040718-264 Predicted to enable GTPase activator activity. Predicted to be involved in G protein-coupled acetylcholine receptor signaling pathway; positive regulation of GTPase activity; and regulation of dopamine receptor signaling pathway. Predicted to act upstream of or within G protein-coupled receptor signaling pathway and negative regulation of signal transduction. Predicted to be located in dendrite; neuronal cell body membrane; and nucleus. Predicted to be extrinsic component of cytoplasmic side of plasma membrane. Is expressed in forebrain and retina. Orthologous to human RGS8 (regulator of G protein signaling 8).

Ensembl:

ensembl_id ENSDART00000185907

JBrowse2

Loading

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00065190 lncRNA downstream 372152 35085032 ~ 35090195 (-) True XLOC_032973
TCONS_00064073 lncRNA downstream 423302 35036515 ~ 35039045 (-) False XLOC_032972
TCONS_00065189 lncRNA downstream 504871 34947174 ~ 34957476 (-) False XLOC_032970
TCONS_00064067 lncRNA downstream 504871 34951577 ~ 34957476 (-) True XLOC_032970
TCONS_00064066 lncRNA downstream 508002 34947174 ~ 34954345 (-) False XLOC_032970
TCONS_00064750 lncRNA upstream 276143 35749066 ~ 35749921 (-) True XLOC_032979
TCONS_00064088 lncRNA upstream 437575 35910498 ~ 35914709 (-) False XLOC_032980
TCONS_00064087 lncRNA upstream 437575 35910498 ~ 35914709 (-) False XLOC_032980
TCONS_00064090 lncRNA upstream 437575 35910498 ~ 35914713 (-) False XLOC_032980
TCONS_00064089 lncRNA upstream 438602 35911525 ~ 35914410 (-) False XLOC_032980
TCONS_00064081 mRNA downstream 16237 35443430 ~ 35446110 (-) True XLOC_032976
TCONS_00064080 mRNA downstream 22941 35395050 ~ 35439406 (-) True XLOC_032975
TCONS_00064079 mRNA downstream 61065 35387367 ~ 35401282 (-) False XLOC_032975
TCONS_00064078 mRNA downstream 152123 35136450 ~ 35310224 (-) True XLOC_032974
TCONS_00064077 mRNA downstream 152686 35106115 ~ 35309661 (-) False XLOC_032974
TCONS_00064085 mRNA upstream 202861 35675784 ~ 35779348 (-) False XLOC_032978
TCONS_00064086 mRNA upstream 202951 35675874 ~ 35738836 (-) True XLOC_032978
TCONS_00064092 mRNA upstream 654582 36127505 ~ 36198052 (-) False XLOC_032982
TCONS_00064093 mRNA upstream 658108 36131031 ~ 36182115 (-) False XLOC_032982
TCONS_00064098 mRNA upstream 1078160 36551083 ~ 36552844 (-) False XLOC_032986
TCONS_00064062 other downstream 523640 34932623 ~ 34938707 (-) False XLOC_032969
TCONS_00064061 other downstream 523654 34931950 ~ 34938693 (-) False XLOC_032969
TCONS_00064063 other downstream 523654 34932956 ~ 34938693 (-) False XLOC_032969
TCONS_00064064 other downstream 523661 34933586 ~ 34938686 (-) True XLOC_032969
TCONS_00064057 other downstream 624048 34833148 ~ 34838299 (-) True XLOC_032967
TCONS_00064091 other upstream 439698 35912621 ~ 35913507 (-) False XLOC_032980
TCONS_00064094 other upstream 705422 36178345 ~ 36197764 (-) True XLOC_032982
TCONS_00064097 other upstream 1006270 36479193 ~ 36502330 (-) True XLOC_032985
TCONS_00064104 other upstream 1260786 36733709 ~ 36733826 (-) True XLOC_032989
TCONS_00064105 other upstream 1271211 36744134 ~ 36744251 (-) True XLOC_032990

Expression Profile

Expression of TCONS_00064084 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.
//

Expression of TCONS_00064084 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
rainbow trout (Oncorhynchus mykiss) TU817090 True 863 TUCP 0.46 2 NC_048572.1 50936928 ~ 50939471 (-)