RNA id: TCONS_00064424


Basic Information

Item Value
RNA id TCONS_00064424
length 588
RNA type mRNA
GC content 0.55
exon number 1
gene id XLOC_033154
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 49169420 ~ 49215827 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCATGCGGTGGTCCATGCTAGTCCTGCTGCTCCTGTCCTGCAGCCAGACGTTTGCCCAGCGCCCAGGAGACATCTGCCCACAAAACCCCCACCACGGTCAAGATGTCACAGCCAACACTGTGCCCACCGTGGATCCCAAACTCTTCAACAAGAGGCGGTACCGCTCACCACGCGTGCTCTTCAGCGAACACCCGCCCGACTCTGAACCCTCCCGGAGCAGGACCAAGAGGAAAGCAGGACCGCCTCAACATCGCGGCGTTTACTCCGTCTGCGAGAGCATCAGCCATTGGGAGGGAAATAAAACCAAAGCCACAGACATCACAGGCAATGAGGTCACCGTTTTACCTGACGTAATCATCAACAACTCCAAGAAAAAGCAATACTTTTTTGAGACCACCTGCAGCAGCGGGCGAACCGGAGGCTCTGGGTGTTTAGGGATCGACGCCCGCCATTGGAACTCATATTGCACCAATTCGCATACATTTGTACGTGCGCTGACTTCATTCAAGAACCTGGTGGCGTGGAGACTCATAAGGATCAATGTAGCTTGCGTGTGTGTGCTGAGCAGAAAGTCTTGGAGAGCATGAC

Function

GO:

id name namespace
GO:0033138 positive regulation of peptidyl-serine phosphorylation biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0007613 memory biological_process
GO:0021675 nerve development biological_process
GO:0038180 nerve growth factor signaling pathway biological_process
GO:0048672 positive regulation of collateral sprouting biological_process
GO:0050804 modulation of chemical synaptic transmission biological_process
GO:0045664 regulation of neuron differentiation biological_process
GO:0007422 peripheral nervous system development biological_process
GO:0043524 negative regulation of neuron apoptotic process biological_process
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway biological_process
GO:0030424 axon cellular_component
GO:0030425 dendrite cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0031410 cytoplasmic vesicle cellular_component
GO:0008021 synaptic vesicle cellular_component
GO:0005102 signaling receptor binding molecular_function
GO:0005163 nerve growth factor receptor binding molecular_function
GO:0008083 growth factor activity molecular_function

KEGG:

id description
ko04010 MAPK signaling pathway
ko04014 Ras signaling pathway
ko04015 Rap1 signaling pathway
ko04020 Calcium signaling pathway
ko04151 PI3K-Akt signaling pathway
ko04060 Cytokine-cytokine receptor interaction
ko04210 Apoptosis
ko04722 Neurotrophin signaling pathway
ko04750 Inflammatory mediator regulation of TRP channels
ko03110 Chaperones and folding catalysts
ko04052 Cytokines and growth factors

ZFIN:

id description
ZDB-GENE-000629-2 Predicted to enable growth factor activity and nerve growth factor receptor binding activity. Predicted to be involved in several processes, including cell surface receptor signaling pathway; nervous system development; and positive regulation of peptidyl-serine phosphorylation. Predicted to be located in extracellular region. Predicted to be active in several cellular components, including axon; dendrite; and synaptic vesicle. Is expressed in several structures, including alar plate midbrain region; head mesenchyme; nervous system; periderm; and segmental plate. Human ortholog(s) of this gene implicated in several diseases, including IgA glomerulonephritis; end stage renal disease; hereditary sensory and autonomic neuropathy type 5; interstitial cystitis; and neurogenic bladder. Orthologous to human NGF (nerve growth factor).

Ensembl:

ensembl_id ENSDART00000182255

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00065226 lncRNA downstream 65611 49100879 ~ 49104192 (-) True XLOC_033152
TCONS_00065225 lncRNA downstream 220288 48922587 ~ 48949515 (-) True XLOC_033149
TCONS_00065224 lncRNA downstream 220310 48914868 ~ 48949493 (-) False XLOC_033149
TCONS_00064756 lncRNA downstream 1108144 48046286 ~ 48061659 (-) True XLOC_033141
TCONS_00064401 lncRNA downstream 1108279 47979305 ~ 48061524 (-) False XLOC_033141
TCONS_00064425 lncRNA upstream 140518 49310908 ~ 49322485 (-) False XLOC_033155
TCONS_00065227 lncRNA upstream 149619 49320009 ~ 49322485 (-) False XLOC_033155
TCONS_00065228 lncRNA upstream 149619 49320009 ~ 49322490 (-) False XLOC_033155
TCONS_00064426 lncRNA upstream 149619 49320009 ~ 49322513 (-) False XLOC_033155
TCONS_00065229 lncRNA upstream 149619 49320009 ~ 49322524 (-) False XLOC_033155
TCONS_00064416 mRNA downstream 10596 49107048 ~ 49159207 (-) False XLOC_033153
TCONS_00064415 mRNA downstream 91101 49071096 ~ 49078702 (-) True XLOC_033151
TCONS_00064414 mRNA downstream 91540 49063289 ~ 49078263 (-) False XLOC_033151
TCONS_00064413 mRNA downstream 106718 49061077 ~ 49063085 (-) True XLOC_033150
TCONS_00064411 mRNA downstream 696408 48426649 ~ 48473395 (-) True XLOC_033147
TCONS_00064427 mRNA upstream 338415 49508805 ~ 49510553 (-) True XLOC_033156
TCONS_00064428 mRNA upstream 349734 49520124 ~ 49526510 (-) True XLOC_033157
TCONS_00064429 mRNA upstream 358624 49529014 ~ 49537646 (-) True XLOC_033158
TCONS_00064430 mRNA upstream 370888 49541278 ~ 49547680 (-) True XLOC_033159
TCONS_00064431 mRNA upstream 415071 49585461 ~ 49655235 (-) True XLOC_033160
TCONS_00064417 other downstream 10709 49116019 ~ 49159094 (-) True XLOC_033153
TCONS_00064412 other downstream 557653 48612034 ~ 48612150 (-) True XLOC_033148
TCONS_00064408 other downstream 788580 48380245 ~ 48381223 (-) True XLOC_033145
TCONS_00064395 other downstream 1567088 47602599 ~ 47602715 (-) True XLOC_033138
TCONS_00064391 other downstream 2013387 47156302 ~ 47156416 (-) True XLOC_033135
TCONS_00064440 other upstream 723098 49893488 ~ 49902140 (-) True XLOC_033166
TCONS_00064447 other upstream 964929 50135319 ~ 50135437 (-) True XLOC_033171
TCONS_00064450 other upstream 1415112 50585502 ~ 50587730 (-) True XLOC_033175
TCONS_00064454 other upstream 1571925 50742315 ~ 50744929 (-) False XLOC_033178
TCONS_00064455 other upstream 1573770 50744160 ~ 50745255 (-) False XLOC_033178

Expression Profile

//