RNA id: TCONS_00064450


Basic Information

Item Value
RNA id TCONS_00064450
length 327
RNA type processed_transcript
GC content 0.52
exon number 2
gene id XLOC_033175
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 50580940 ~ 50685862 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACTTAATTCTGAAGCTCCTCGAACCAGCAGGGATTCCCTTCACTGCTCCAGCGGATACAGCACTCAGACCACCACGCCATCCTGCTCTGAAGACACCATCCCGTCACAGCACGACTATGACTACATCTCTCTGCATGGAGGAGAGGATGCTCACAGCCAGTCTGATTTTGATAAATCTTCCACAATTCCTCGCAACAGTGACCTGAGTCTCAATTACCGCAAAATGTTTCAAAGCAAGAGGCCGGCATCTACCGTCAGTCTGCTGATGGATCCAGAGCCTTTAGGTCCTCACACAGCCACCATCCGCCGTAAACCCTCCAGCAAGC

Function

GO:

id name namespace
GO:0007009 plasma membrane organization biological_process
GO:0003779 actin binding molecular_function

KEGG:

id description
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-081105-141 Predicted to enable actin binding activity. Predicted to act upstream of or within plasma membrane organization. Orthologous to human MTSS1 (MTSS I-BAR domain containing 1).

Ensembl:

ensembl_id ENSDART00000151500

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00065237 lncRNA downstream 80064 50495622 ~ 50505438 (-) True XLOC_033174
TCONS_00065236 lncRNA downstream 89619 50480139 ~ 50495883 (-) False XLOC_033174
TCONS_00065235 lncRNA downstream 98997 50480139 ~ 50486505 (-) False XLOC_033174
TCONS_00064757 lncRNA downstream 101104 50476213 ~ 50484398 (-) False XLOC_033174
TCONS_00065234 lncRNA downstream 109013 50457968 ~ 50476489 (-) False XLOC_033174
TCONS_00065238 lncRNA upstream 941033 51528763 ~ 51538548 (-) False XLOC_033181
TCONS_00065239 lncRNA upstream 1438761 52026491 ~ 52034656 (-) True XLOC_033186
TCONS_00064474 lncRNA upstream 1644021 52231751 ~ 52234719 (-) False XLOC_033188
TCONS_00064475 lncRNA upstream 1644132 52231862 ~ 52234719 (-) False XLOC_033188
TCONS_00064476 lncRNA upstream 1646011 52233741 ~ 52234648 (-) True XLOC_033188
TCONS_00064448 mRNA downstream 180770 50401620 ~ 50404732 (-) True XLOC_033173
TCONS_00064444 mRNA downstream 381240 50021410 ~ 50204262 (-) False XLOC_033170
TCONS_00064445 mRNA downstream 381820 50022150 ~ 50203682 (-) False XLOC_033170
TCONS_00064446 mRNA downstream 381820 50027209 ~ 50203682 (-) True XLOC_033170
TCONS_00064443 mRNA downstream 602173 49975910 ~ 49983329 (-) True XLOC_033169
TCONS_00064451 mRNA upstream 107651 50695381 ~ 50704689 (-) True XLOC_033176
TCONS_00064452 mRNA upstream 126070 50713800 ~ 50730749 (-) False XLOC_033177
TCONS_00064453 mRNA upstream 126628 50714358 ~ 50730749 (-) True XLOC_033177
TCONS_00064458 mRNA upstream 422251 51009981 ~ 51101834 (-) False XLOC_033180
TCONS_00064461 mRNA upstream 433188 51020918 ~ 51386696 (-) False XLOC_033180
TCONS_00064447 other downstream 450065 50135319 ~ 50135437 (-) True XLOC_033171
TCONS_00064440 other downstream 683362 49893488 ~ 49902140 (-) True XLOC_033166
TCONS_00064417 other downstream 1426408 49116019 ~ 49159094 (-) True XLOC_033153
TCONS_00064412 other downstream 1973352 48612034 ~ 48612150 (-) True XLOC_033148
TCONS_00064408 other downstream 2204279 48380245 ~ 48381223 (-) True XLOC_033145
TCONS_00064454 other upstream 154585 50742315 ~ 50744929 (-) False XLOC_033178
TCONS_00064455 other upstream 156430 50744160 ~ 50745255 (-) False XLOC_033178
TCONS_00064456 other upstream 156435 50744165 ~ 50747545 (-) True XLOC_033178
TCONS_00064457 other upstream 166771 50754501 ~ 50756448 (-) True XLOC_033179
TCONS_00064464 other upstream 943276 51531006 ~ 51541488 (-) True XLOC_033181

Expression Profile

//