RNA id: TCONS_00064513


Basic Information

Item Value
RNA id TCONS_00064513
length 350
RNA type mRNA
GC content 0.48
exon number 3
gene id XLOC_033211
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 54117004 ~ 54126463 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGGAGGCAGTGGATCCAAACCCAAAGGAGTTTGGCCTTTTACCAGCTCAGCGGCTGGAGGAGAAGCTCCCGGGGAGGGCAGCGAACAGTGTTTAGCACGTCTGCGAGGATCCAAGAATGCCACACCATTTGTTTTCACAAGGAGAAGCTCCTTGTATTTTGATGAAGATGGAGATCTGGCTCATGAATTTTATGAGGAGACTGTGGTGACCAAGAACGGCAGAAAGAAAGCAAAGCTGAAGAGAATTCAGAAAAACCTTATACCTCAGGGAATAGTGAAATTAGATCACCCCCGAATCCACGTGGACTTTCCTGTGATCCTGTGTGAAATCTGACATGATCCCGGACG

Function

GO:

id name namespace
GO:0006954 inflammatory response biological_process
GO:0051881 regulation of mitochondrial membrane potential biological_process
GO:0005739 mitochondrion cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-061013-612 Predicted to be involved in inflammatory response and regulation of mitochondrial membrane potential. Predicted to be active in mitochondrion. Orthologous to human TUSC2 (tumor suppressor 2, mitochondrial calcium regulator).

Ensembl:

ensembl_id ENSDART00000183970

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00064759 lncRNA downstream 426726 53611115 ~ 53690618 (-) True XLOC_033208
TCONS_00064500 lncRNA downstream 834771 53273840 ~ 53282573 (-) False XLOC_033204
TCONS_00064758 lncRNA downstream 859276 53252557 ~ 53258068 (-) True XLOC_033203
TCONS_00064475 lncRNA downstream 1882625 52231862 ~ 52234719 (-) False XLOC_033188
TCONS_00065240 lncRNA upstream 43897 54164932 ~ 54173201 (-) False XLOC_033212
TCONS_00065242 lncRNA upstream 43897 54164932 ~ 54174073 (-) False XLOC_033212
TCONS_00065241 lncRNA upstream 43897 54164932 ~ 54174073 (-) True XLOC_033212
TCONS_00064516 lncRNA upstream 56038 54177073 ~ 54180647 (-) False XLOC_033213
TCONS_00065243 lncRNA upstream 376769 54497804 ~ 54522947 (-) False XLOC_033220
TCONS_00064510 mRNA downstream 5416 54093057 ~ 54111928 (-) False XLOC_033210
TCONS_00064511 mRNA downstream 10075 54093505 ~ 54107269 (-) True XLOC_033210
TCONS_00064509 mRNA downstream 38721 54063032 ~ 54078623 (-) True XLOC_033209
TCONS_00064508 mRNA downstream 231830 53503273 ~ 53885514 (-) False XLOC_033208
TCONS_00064507 mRNA downstream 690571 53394125 ~ 53426773 (-) True XLOC_033207
TCONS_00064514 mRNA upstream 53661 54174696 ~ 54180699 (-) False XLOC_033213
TCONS_00064515 mRNA upstream 53747 54174782 ~ 54179860 (-) False XLOC_033213
TCONS_00064517 mRNA upstream 56427 54177462 ~ 54180516 (-) True XLOC_033213
TCONS_00064518 mRNA upstream 159330 54280365 ~ 54290227 (-) True XLOC_033214
TCONS_00064519 mRNA upstream 203973 54325008 ~ 54348568 (-) True XLOC_033215
TCONS_00064499 other downstream 837414 53273836 ~ 53279930 (-) False XLOC_033204
TCONS_00064492 other downstream 1084233 53032996 ~ 53033111 (-) True XLOC_033199
TCONS_00064491 other downstream 1193855 52923373 ~ 52923489 (-) True XLOC_033198
TCONS_00064464 other downstream 2575856 51531006 ~ 51541488 (-) True XLOC_033181
TCONS_00064457 other downstream 3360896 50754501 ~ 50756448 (-) True XLOC_033179
TCONS_00064524 other upstream 385423 54506458 ~ 54506586 (-) True XLOC_033221
TCONS_00064525 other upstream 386070 54507105 ~ 54507178 (-) True XLOC_033220
TCONS_00064531 other upstream 693886 54814921 ~ 54815037 (-) True XLOC_033225
TCONS_00064542 other upstream 1426100 55547135 ~ 55547270 (-) True XLOC_033236
TCONS_00064543 other upstream 1434227 55555262 ~ 55555396 (-) True XLOC_033237

Expression Profile

//