RNA id: TCONS_00064525


Basic Information

Item Value
RNA id TCONS_00064525
length 74
RNA type miRNA
GC content 0.36
exon number 1
gene id XLOC_033220
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 54497804 ~ 54523451 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCTGAGGTAGTAGATTGAATAGTTGTGGAGTATAAAACCTCCCTTTGAGATAACTATACAATCTACTGTCTTTC

Function

GO:

id name namespace
GO:0022402 cell cycle process biological_process
GO:1902850 microtubule cytoskeleton organization involved in mitosis biological_process
GO:0009259 ribonucleotide metabolic process biological_process
GO:0046034 ATP metabolic process biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0009060 aerobic respiration biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0140014 mitotic nuclear division biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006120 mitochondrial electron transport, NADH to ubiquinone biological_process
GO:0006123 mitochondrial electron transport, cytochrome c to oxygen biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0022900 electron transport chain biological_process
GO:0022904 respiratory electron transport chain biological_process
GO:0048285 organelle fission biological_process
GO:0006163 purine nucleotide metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:0017144 drug metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0009117 nucleotide metabolic process biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0007049 cell cycle biological_process
GO:0007051 spindle organization biological_process
GO:0007052 mitotic spindle organization biological_process
GO:0055086 nucleobase-containing small molecule metabolic process biological_process
GO:0051276 chromosome organization biological_process
GO:0006753 nucleoside phosphate metabolic process biological_process
GO:0019646 aerobic electron transport chain biological_process
GO:0009141 nucleoside triphosphate metabolic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:0009150 purine ribonucleotide metabolic process biological_process
GO:0051301 cell division biological_process
GO:0072521 purine-containing compound metabolic process biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0019693 ribose phosphate metabolic process biological_process
GO:1903047 mitotic cell cycle process biological_process
GO:0009199 ribonucleoside triphosphate metabolic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0045333 cellular respiration biological_process
GO:0008380 RNA splicing biological_process
GO:0000280 nuclear division biological_process
GO:0098803 respiratory chain complex cellular_component
GO:0005743 mitochondrial inner membrane cellular_component
GO:0005746 mitochondrial respirasome cellular_component
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0000793 condensed chromosome cellular_component
GO:0000794 condensed nuclear chromosome cellular_component
GO:0030964 NADH dehydrogenase complex cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0044429 obsolete mitochondrial part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0044455 obsolete mitochondrial membrane part cellular_component
GO:0019866 organelle inner membrane cellular_component
GO:0032991 protein-containing complex cellular_component
GO:1990204 oxidoreductase complex cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005634 nucleus cellular_component
GO:0005654 nucleoplasm cellular_component
GO:0045271 respiratory chain complex I cellular_component
GO:0031966 mitochondrial membrane cellular_component
GO:0031967 organelle envelope cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031975 envelope cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043226 organelle cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0070469 respirasome cellular_component
GO:0098798 mitochondrial protein-containing complex cellular_component
GO:0098800 inner mitochondrial membrane protein complex cellular_component
GO:0005740 mitochondrial envelope cellular_component
GO:0009055 electron transfer activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko04623 Cytosolic DNA-sensing pathway
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000119030

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00064516 lncRNA downstream 326458 54177073 ~ 54180647 (-) False XLOC_033213
TCONS_00065242 lncRNA downstream 333032 54164932 ~ 54174073 (-) False XLOC_033212
TCONS_00065241 lncRNA downstream 333032 54164932 ~ 54174073 (-) True XLOC_033212
TCONS_00065240 lncRNA downstream 333904 54164932 ~ 54173201 (-) False XLOC_033212
TCONS_00064759 lncRNA downstream 816487 53611115 ~ 53690618 (-) True XLOC_033208
TCONS_00065248 lncRNA upstream 240770 54747948 ~ 54754115 (-) False XLOC_033222
TCONS_00065249 lncRNA upstream 243754 54750932 ~ 54753873 (-) True XLOC_033222
TCONS_00064760 lncRNA upstream 311320 54818498 ~ 54826011 (-) True XLOC_033224
TCONS_00064761 lncRNA upstream 334218 54841396 ~ 54843429 (-) True XLOC_033226
TCONS_00065250 lncRNA upstream 368999 54876177 ~ 54886649 (-) False XLOC_033227
TCONS_00064523 mRNA downstream 20695 54481941 ~ 54486410 (-) True XLOC_033219
TCONS_00064522 mRNA downstream 41728 54459413 ~ 54465377 (-) True XLOC_033218
TCONS_00064521 mRNA downstream 62176 54438355 ~ 54444929 (-) True XLOC_033217
TCONS_00064520 mRNA downstream 73110 54430413 ~ 54433995 (-) True XLOC_033216
TCONS_00064519 mRNA downstream 158537 54325008 ~ 54348568 (-) True XLOC_033215
TCONS_00064526 mRNA upstream 253963 54761141 ~ 54796072 (-) True XLOC_033223
TCONS_00064528 mRNA upstream 297958 54805136 ~ 54815886 (-) False XLOC_033224
TCONS_00064527 mRNA upstream 297958 54805136 ~ 54815886 (-) False XLOC_033224
TCONS_00064529 mRNA upstream 299758 54806936 ~ 54826061 (-) False XLOC_033224
TCONS_00064530 mRNA upstream 300147 54807325 ~ 54816567 (-) False XLOC_033224
TCONS_00064524 other downstream 519 54506458 ~ 54506586 (-) True XLOC_033221
TCONS_00064499 other downstream 1227175 53273836 ~ 53279930 (-) False XLOC_033204
TCONS_00064492 other downstream 1473994 53032996 ~ 53033111 (-) True XLOC_033199
TCONS_00064491 other downstream 1583616 52923373 ~ 52923489 (-) True XLOC_033198
TCONS_00064464 other downstream 2965617 51531006 ~ 51541488 (-) True XLOC_033181
TCONS_00064531 other upstream 307743 54814921 ~ 54815037 (-) True XLOC_033225
TCONS_00064542 other upstream 1039957 55547135 ~ 55547270 (-) True XLOC_033236
TCONS_00064543 other upstream 1048084 55555262 ~ 55555396 (-) True XLOC_033237
TCONS_00064544 other upstream 1142941 55650119 ~ 55650251 (-) True XLOC_033238
TCONS_00064551 other upstream 2031831 56539009 ~ 56539125 (-) True XLOC_033247