RNA id: TU105281



Basic Information


Item Value
RNA id TU105281
length 558
lncRNA type inter_gene
GC content 0.55
exon number 2
gene id G78716
representative True

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 35962773 ~ 35963505 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


actgactgctgctctcccctactgactgctgctctcccctactgactgctgctctctcctactgactgctgctctctcctactgactgctgctctcccctactgactgctgctctctcctactgactgctgctctcctactgactgctgctctcccctactgactgctactctctcctactgactgctgctctctcctactgactgctgctctcccctactgactgctactctctcctactgactgctactctctcctactgactgctactctctcctactgactgctactctctcctactgactgctgctctcccctactgactgctgctctcctactgactgctgctctcccctactgactgctactctctcctactgactgctgctctctcctactgactgctgctcccctactgactgctgctctctactgctgctgctgctctcctactgactgctgctctcccctactgactgctactctctcctactgactgctgctctctcctactgactgctgctctctcctactgactgctactctctcctactgact

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU105272 lncRNA upstream 33877 35928440 ~ 35928896 (+) True G78707
TU105271 lncRNA upstream 53704 35908820 ~ 35909069 (+) True G78706
TU105270 lncRNA upstream 54538 35908026 ~ 35908235 (+) True G78705
TU105215 lncRNA upstream 141132 35821290 ~ 35821641 (+) True G78674
TU105209 lncRNA upstream 149166 35783426 ~ 35813607 (+) False G78669
TU105307 lncRNA downstream 70843 36034348 ~ 36034652 (+) True G78736
TU105328 lncRNA downstream 124368 36087873 ~ 36088096 (+) True G78756
TU105344 lncRNA downstream 147346 36110851 ~ 36190839 (+) False G78759
TU105341 lncRNA downstream 165374 36128879 ~ 36159302 (+) False G78759
TU105342 lncRNA downstream 165374 36128879 ~ 36133280 (+) True G78759
XM_039805921.1 mRNA upstream 61881 35896350 ~ 35900892 (+) True LOC120562276
XM_039806167.1 mRNA upstream 78838 35875127 ~ 35883935 (+) True LOC120562454
XM_039805923.1 mRNA upstream 90529 35865849 ~ 35872244 (+) True LOC120562279
XM_039805924.1 mRNA upstream 90529 35865849 ~ 35872244 (+) False LOC120562279
XM_039805922.1 mRNA upstream 106037 35849473 ~ 35856736 (+) True LOC120562277
XM_039807298.1 mRNA downstream 61121 36024626 ~ 36026571 (+) True LOC120563160
XM_039807323.1 mRNA downstream 128694 36092199 ~ 36110132 (+) True dek
XM_039807327.1 mRNA downstream 147545 36111050 ~ 36129242 (+) False LOC120563175
XM_039807328.1 mRNA downstream 148578 36112083 ~ 36129242 (+) False LOC120563175
XM_039807324.1 mRNA downstream 153245 36116750 ~ 36129242 (+) True LOC120563175
TU105193 other upstream 74601 35865842 ~ 35888172 (+) False LOC120562279
TU105077 other upstream 554091 35405375 ~ 35408682 (+) True G78594
unassigned_transcript_361 other upstream 774574 35188118 ~ 35188199 (+) True trnas-aga_7
TU104752 other upstream 1106241 34839157 ~ 34856532 (+) False LOC120562567
TU104540 other upstream 1418394 34529355 ~ 34544379 (+) False G78200
TU105334 other downstream 174254 36137759 ~ 36141222 (+) False G78759
TU105369 other downstream 330482 36293987 ~ 36350995 (+) True G78772
TU105393 other downstream 428747 36392252 ~ 36434225 (+) False LOC120563181
TU105394 other downstream 428747 36392252 ~ 36465230 (+) False LOC120563181
TU105437 other downstream 727888 36691393 ~ 36703865 (+) True LOC120562457

Expression Profile


TU105281 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU105281 Expression in each Bioproject

Bar chart with 8 bars.
TU105281 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.