RNA id: TU106977



Basic Information


Item Value
RNA id TU106977
length 280
lncRNA type inter_gene
GC content 0.50
exon number 3
gene id G79865
representative False

Chromosome Information


Item Value
chromosome id NC_053118.1
NCBI id CM020915.1
chromosome length 43092710
location 39384949 ~ 39430672 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


cgctgtttctgtgtgtgtgtgtgtctgtctgtctgacagtgtgtgtgtgtgtgtctgtctgtgtgtgtgtctgtctgtctgtgtgtgtctgtctgactgtgtgtgtgtgtgtgtctctgtgtctgtctgacagtgtgtgtgtgtgtgtgtctgtctgtctgtctgtgtgtgtctgtctgtgtgtgtctctgtctgacagtgtgtgtgtctgtctgtctgtctgtgtgtgtgtctgtctgtctgtgtgtctctgtgtgtgtgtgtgtgtgtgtgtgtgtct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU106982 lncRNA downstream 6975 39380288 ~ 39381643 (-) True G79868
TU106961 lncRNA downstream 37965 39323277 ~ 39350653 (-) True G79857
TU106949 lncRNA downstream 42188 39279243 ~ 39346430 (-) True G79847
TU106957 lncRNA downstream 69376 39318259 ~ 39319242 (-) True G79854
TU106935 lncRNA downstream 80878 39196522 ~ 39307740 (-) True G79835
TU106979 lncRNA upstream 448 39423957 ~ 39424691 (-) True G79866
TU107007 lncRNA upstream 5929 39429438 ~ 39430275 (-) True G79877
TU106996 lncRNA upstream 10658 39434167 ~ 39456639 (-) False G79872
TU107009 lncRNA upstream 26959 39450468 ~ 39451237 (-) True G79879
TU107012 lncRNA upstream 26959 39450468 ~ 39451237 (-) False G79879
XM_039806200.1 mRNA downstream 245913 39107304 ~ 39142705 (-) True LOC120562487
XM_039807002.1 mRNA downstream 443443 38908049 ~ 38945175 (-) False trim33l
XM_039807003.1 mRNA downstream 443443 38908049 ~ 38945175 (-) False trim33l
XM_039807001.1 mRNA downstream 443443 38908049 ~ 38945175 (-) True trim33l
XM_039807041.1 mRNA downstream 708138 38666267 ~ 38680480 (-) True nudt17
XM_039806073.1 mRNA upstream 409644 39833153 ~ 39843176 (-) True LOC120562358
XM_039806072.1 mRNA upstream 478256 39901765 ~ 39923149 (-) True LOC120562356
XM_039806077.1 mRNA upstream 701916 40125425 ~ 40175116 (-) True LOC120562362
XM_039806083.1 mRNA upstream 756833 40180342 ~ 40201133 (-) True LOC120562374
XM_039806082.1 mRNA upstream 756834 40180343 ~ 40201131 (-) False LOC120562374
TU106912 other downstream 250236 39097772 ~ 39138382 (-) True G79820
TU106828 other downstream 480597 38906780 ~ 38908021 (-) False G79767
TU106829 other downstream 480597 38906780 ~ 38908021 (-) True G79767
TU106776 other downstream 708154 38672002 ~ 38680464 (-) False nudt17
TU106520 other downstream 1064408 38321011 ~ 38324210 (-) False LOC120562482
TU106993 other upstream 9915 39433424 ~ 39456639 (-) True G79872
TU107259 other upstream 153154 39576663 ~ 39577939 (-) True G80027
TU107282 other upstream 355946 39779455 ~ 39849009 (-) True G80046
XR_005639764.1 other upstream 779530 40203039 ~ 40234663 (-) True LOC120562372
XR_005639763.1 other upstream 781595 40205104 ~ 40234663 (-) False LOC120562372

Expression Profile


TU106977 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU106977 Expression in each Bioproject

Bar chart with 4 bars.
TU106977 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.