RNA id: TCONS_00006564


Basic Information

Item Value
RNA id TCONS_00006564
length 311
RNA type mRNA
GC content 0.46
exon number 6
gene id XLOC_003351
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 14321113 ~ 14342507 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGAGCTGTTGTTCCTCGGTGTGCAATGGACGGCCGCCTAGAGACTGAATTGTATCCTATGGGATCAAGTTATGCAGAATTAGAACCTGGATTAAACCAGACAGACATGCATGACATGCAGCATGTAAGATGATACACAAAAACTGAAACCACACCCCAGCGTTGTTCATGATATTGCAGTTGGTACAAAGAGAGGATCTGACGAATTGTTCTCCTGTGTTACCAGTGGGCCTTATATCATGAGCTCAGCAGCCAACGGCAACGACAGCAAGAAATTCAAAGGTGACATTAGAAGTCCTGCCGTCCCGTCCA

Function

GO:

id name namespace
GO:0006397 mRNA processing biological_process
GO:0006417 regulation of translation biological_process
GO:0045595 regulation of cell differentiation biological_process
GO:0048025 negative regulation of mRNA splicing, via spliceosome biological_process
GO:0043484 regulation of RNA splicing biological_process
GO:0005634 nucleus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-9796 Predicted to enable mRNA binding activity. Predicted to be involved in regulation of RNA splicing and regulation of cell differentiation. Predicted to act upstream of or within RNA splicing and mRNA processing. Predicted to be active in nucleus. Is expressed in several structures, including EVL; axis; mesoderm; nervous system; and pronephric duct. Orthologous to human PTBP1 (polypyrimidine tract binding protein 1).

Ensembl:

ensembl_id ENSDART00000132997

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006546 lncRNA upstream 239017 14081540 ~ 14082177 (+) True XLOC_003344
TCONS_00006539 lncRNA upstream 671936 13642161 ~ 13649258 (+) True XLOC_003340
TCONS_00008575 lncRNA upstream 1126597 13193723 ~ 13194597 (+) False XLOC_003332
TCONS_00006523 lncRNA upstream 1132188 13188135 ~ 13189006 (+) True XLOC_003331
TCONS_00006518 lncRNA upstream 1168809 13151919 ~ 13152385 (+) True XLOC_003329
TCONS_00006567 lncRNA downstream 7138 14334243 ~ 14338679 (+) True XLOC_003351
TCONS_00008576 lncRNA downstream 16340 14343445 ~ 14346112 (+) False XLOC_003352
TCONS_00006570 lncRNA downstream 17474 14344579 ~ 14345138 (+) True XLOC_003352
TCONS_00006575 lncRNA downstream 535181 14862286 ~ 14863542 (+) False XLOC_003355
TCONS_00008577 lncRNA downstream 535311 14862416 ~ 14863275 (+) True XLOC_003355
TCONS_00006561 mRNA upstream 2107 14312260 ~ 14319087 (+) True XLOC_003350
TCONS_00006560 mRNA upstream 20941 14295011 ~ 14300253 (+) True XLOC_003349
TCONS_00006559 mRNA upstream 28168 14287427 ~ 14293026 (+) True XLOC_003348
TCONS_00006557 mRNA upstream 32918 14284866 ~ 14288276 (+) False XLOC_003348
TCONS_00006566 mRNA downstream 6336 14333441 ~ 14340783 (+) False XLOC_003351
TCONS_00006568 mRNA downstream 16340 14343445 ~ 14345429 (+) False XLOC_003352
TCONS_00006569 mRNA downstream 16341 14343446 ~ 14346112 (+) False XLOC_003352
TCONS_00006573 mRNA downstream 295274 14622379 ~ 14640317 (+) True XLOC_003353
TCONS_00006574 mRNA downstream 349131 14676236 ~ 14751380 (+) True XLOC_003354
TCONS_00006553 other upstream 72754 14199896 ~ 14248440 (+) True XLOC_003347
TCONS_00006541 other upstream 456230 13864846 ~ 13864964 (+) True XLOC_003342
TCONS_00006540 other upstream 503510 13817569 ~ 13817684 (+) True XLOC_003341
TCONS_00006509 other upstream 1374984 12930157 ~ 12946210 (+) True XLOC_003325
TCONS_00006493 other upstream 1609198 12711700 ~ 12711996 (+) True XLOC_003318
TCONS_00006565 other downstream 6336 14333441 ~ 14340783 (+) False XLOC_003351
TCONS_00006571 other downstream 104168 14431273 ~ 14639060 (+) False XLOC_003353
TCONS_00006572 other downstream 104260 14431365 ~ 14440826 (+) False XLOC_003353
TCONS_00006578 other downstream 690080 15017185 ~ 15018524 (+) False XLOC_003358
TCONS_00006591 other downstream 1559865 15886970 ~ 15902195 (+) False XLOC_003365

Expression Profile

//