RNA id: TU137379



Basic Information


Item Value
RNA id TU137379
length 342
lncRNA type inter_gene
GC content 0.46
exon number 2
gene id G102022
representative True

Chromosome Information


Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 41156552 ~ 41157040 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


CCTTGGGGAAGTTGCTCTCCTCATCAATAAGCGCCAGCATGTTCAGGGGTTTGTTGGCCAATACGTCCAGGGTGCATTGGTTGTCTTTGTAGTCTATTTTCTTCCACACAATGTTTTCACGGGCATACTCGTCCTGCTCCAGTTTGAAAACATGCTTGACGAAGAACTGCTGCAACTGCTCATTGGCAAAGTTGATGCACAGCTGCTCAAAGCTGTTTTGGTGAAGTTCTCAAAACCAAAGATGTCGAGCAAGCCTATTGACTGTTGGGAATCCTCAGGTGGCTTGTAAATGGCAGCATTGATTTTGTCCACGACCCAAAGGAAAAGTCTTCCATAAATAGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU137378 lncRNA upstream 85 41154922 ~ 41156467 (+) True G102021
TU137361 lncRNA upstream 42317 41111573 ~ 41114235 (+) True G102006
TU137362 lncRNA upstream 42317 41113276 ~ 41114235 (+) False G102006
TU137338 lncRNA upstream 216235 40860037 ~ 40940317 (+) True G101990
TU137134 lncRNA upstream 647185 40508891 ~ 40509367 (+) True G101832
TU137438 lncRNA downstream 52620 41209660 ~ 41268656 (+) True G102074
TU137445 lncRNA downstream 74627 41231667 ~ 41234402 (+) True G102081
TU137567 lncRNA downstream 354944 41511984 ~ 41512370 (+) True G102189
XM_039811640.1 mRNA upstream 50804 41086373 ~ 41105748 (+) True bcl6aa
XM_039811641.1 mRNA upstream 50804 41098958 ~ 41105748 (+) False bcl6aa
XM_039811886.1 mRNA upstream 409175 40737734 ~ 40747377 (+) True zbtb11
XM_039812404.1 mRNA upstream 433717 40715933 ~ 40722835 (+) True dpt
XM_039810126.1 mRNA upstream 473310 40657846 ~ 40683242 (+) True nme7
XM_039810211.1 mRNA downstream 69570 41226610 ~ 41227656 (+) True im:7152348
XM_039811878.1 mRNA downstream 370361 41527401 ~ 41533655 (+) True zgc:103559
XM_039811879.1 mRNA downstream 370361 41527401 ~ 41533655 (+) False zgc:103559
XR_005640166.1 other upstream 603595 40515093 ~ 40552957 (+) False atp10a
TU136718 other upstream 1590597 39561122 ~ 39565955 (+) False reps2
TU136690 other upstream 1692102 39460446 ~ 39464450 (+) False LOC120565708
TU136417 other upstream 2275947 38877211 ~ 38880605 (+) False usp46
TU135875 other upstream 3666480 37463914 ~ 37490072 (+) True G100843
unassigned_transcript_390 other downstream 68051 41225091 ~ 41225162 (+) True trnap-cgg_3
unassigned_transcript_391 other downstream 68594 41225634 ~ 41225705 (+) True trnap-ugg_3
TU137538 other downstream 295634 41452674 ~ 41453306 (+) True G102165

Expression Profile


TU137379 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

TU137379 Expression in each Bioproject

Bar chart with 1 bar.
TU137379 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 0.6.
End of interactive chart.