RNA id: TU150504



Basic Information


Item Value
RNA id TU150504
length 226
lncRNA type sense_over
GC content 0.54
exon number 2
gene id G111700
representative True

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 3251454 ~ 3291846 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


cctcaagatagcaatactcccagaatgcaactgaacacacctccctgtaagaccagcacgcccagaatgcacctgaacacacctccctgtaagaccagcatgcccagaatgcacctgaacacacctccctgtaagaccagcatgcccagaatgcacctgaacacacctccctgtaagaccagcacgccccagaatgcacctgaacacacctccctgtaagaccagc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU150489 lncRNA downstream 42794 3140019 ~ 3208660 (-) True G111685
TU150446 lncRNA downstream 105577 3070612 ~ 3145877 (-) True G111662
TU150494 lncRNA downstream 133420 3117616 ~ 3118034 (-) True G111690
TU150464 lncRNA downstream 151121 3096244 ~ 3100333 (-) False G111678
TU150463 lncRNA downstream 151121 3096596 ~ 3100333 (-) True G111678
TU150474 lncRNA upstream 1431 3293277 ~ 3304338 (-) False G111683
TU150478 lncRNA upstream 1431 3293277 ~ 3304338 (-) False G111683
TU150480 lncRNA upstream 1431 3293277 ~ 3304338 (-) False G111683
TU150470 lncRNA upstream 7469 3299315 ~ 3304338 (-) True G111683
TU150479 lncRNA upstream 7469 3299315 ~ 3304338 (-) False G111683
XM_039815175.1 mRNA downstream 22307 3204287 ~ 3229147 (-) False LOC120568005
XM_039815173.1 mRNA downstream 22307 3212548 ~ 3229147 (-) False LOC120568005
XM_039815174.1 mRNA downstream 22307 3212548 ~ 3229147 (-) True LOC120568005
XM_039815172.1 mRNA downstream 50601 3183582 ~ 3200853 (-) True LOC120568004
XM_039815187.1 mRNA downstream 70149 3158202 ~ 3181305 (-) False LOC120568011
XM_039816093.1 mRNA upstream 57229 3349075 ~ 3371775 (-) False LOC120568520
XM_039816976.1 mRNA upstream 156867 3448713 ~ 3456534 (-) False LOC120569104
XM_039816975.1 mRNA upstream 156867 3448713 ~ 3456534 (-) False LOC120569104
XM_039816974.1 mRNA upstream 156867 3448713 ~ 3456534 (-) False LOC120569104
XM_039816973.1 mRNA upstream 156867 3448713 ~ 3456534 (-) False LOC120569104
XR_005640646.1 other downstream 22307 3204287 ~ 3229147 (-) False LOC120568005
TU150424 other downstream 109584 2985332 ~ 3141870 (-) False LOC120568519
TU150430 other downstream 259608 2985332 ~ 2991846 (-) False LOC120568519
TU150296 other downstream 673440 2573304 ~ 2578014 (-) True G111573
TU150255 other downstream 863157 2341496 ~ 2388297 (-) True LOC120567903
TU150514 other upstream 22800 3314646 ~ 3369939 (-) True LOC120568520
TU150904 other upstream 743696 4035542 ~ 4036963 (-) True G111942
TU151047 other upstream 946256 4238102 ~ 4238670 (-) True G112043
TU151048 other upstream 946256 4238102 ~ 4238670 (-) False G112043
TU151050 other upstream 946256 4238102 ~ 4238670 (-) False G112043

Expression Profile


TU150504 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU150504 Expression in each Bioproject

Bar chart with 5 bars.
TU150504 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.