RNA id: TU162864



Basic Information


Item Value
RNA id TU162864
length 273
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G121024
representative True

Chromosome Information


Item Value
chromosome id NC_053122.1
NCBI id CM020919.1
chromosome length 39550354
location 38187975 ~ 38188247 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


gaggtaccatgctagtgttagcattagcgttagcatgctaatgctaacgctacgagctaacggttgtggttagccagctcatttcggactgtgacgtcacagtccgagccgattttgaacagctcactaggagactgaaggcaggacacattcagaaaccatatctcactcaaaacagcatggatggattttttcaaagtttgtatgtgtgtggaagcaccagagacacaaaagaacaccccaaataccagaaaaagtgtttttttcataata

Function


GO:

id name namespace
GO:0006811 ion transport biological_process

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU162863 lncRNA upstream 31285 38156353 ~ 38156690 (+) True G121023
TU162828 lncRNA upstream 87070 38100144 ~ 38100905 (+) True G120995
TU162830 lncRNA upstream 87070 38100184 ~ 38100905 (+) False G120995
TU162827 lncRNA upstream 145445 38027595 ~ 38042530 (+) True G120994
TU162826 lncRNA upstream 162770 38024995 ~ 38025205 (+) True G120993
TU162873 lncRNA downstream 241414 38429661 ~ 38430105 (+) True G121032
TU162875 lncRNA downstream 246500 38434747 ~ 38435000 (+) True G121034
TU162882 lncRNA downstream 360179 38548426 ~ 38548626 (+) True G121041
TU162884 lncRNA downstream 361423 38549670 ~ 38550038 (+) True G121043
TU162896 lncRNA downstream 493463 38681710 ~ 38682252 (+) True G121053
XM_039814686.1 mRNA upstream 84265 38102577 ~ 38103710 (+) True LOC120567717
XM_039816922.1 mRNA upstream 89729 38039081 ~ 38098246 (+) True LOC120569077
XM_039816923.1 mRNA upstream 89729 38039081 ~ 38098246 (+) False LOC120569077
XM_039815841.1 mRNA upstream 168907 37989565 ~ 38019068 (+) True LOC120568367
XM_039816328.1 mRNA downstream 432089 38620336 ~ 38628410 (+) True LOC120568674
XM_039814943.1 mRNA downstream 630800 38819047 ~ 38843071 (+) True pitrm1
XM_039816250.1 mRNA downstream 1297883 39486130 ~ 39522532 (+) False frrs1a
XM_039816251.1 mRNA downstream 1297883 39486130 ~ 39522470 (+) False frrs1a
XM_039816254.1 mRNA downstream 1297883 39486130 ~ 39522239 (+) False frrs1a
TU162816 other upstream 168937 38011877 ~ 38019038 (+) False LOC120568367
TU162730 other upstream 881961 37302894 ~ 37306014 (+) True G120914
TU162632 other upstream 1169185 37010999 ~ 37018790 (+) False LOC120568208
TU162480 other upstream 1781286 36406121 ~ 36406689 (+) True G120717
TU162479 other upstream 1782202 36405240 ~ 36405773 (+) True G120716
unassigned_transcript_597 other downstream 8794 38197041 ~ 38197122 (+) True trnas-cga_7
TU162901 other downstream 567437 38755684 ~ 38755931 (+) True G121058
TU163034 other downstream 1203725 39391972 ~ 39392776 (+) True G121171

Expression Profile


TU162864 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

TU162864 Expression in each Bioproject

Bar chart with 8 bars.
TU162864 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.