RNA id: TU19318



Basic Information


Item Value
RNA id TU19318
length 269
lncRNA type intronic
GC content 0.42
exon number 2
gene id G14481
representative True

Chromosome Information


Item Value
chromosome id NC_053113.1
NCBI id CM020910.1
chromosome length 48524041
location 3690280 ~ 3690581 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


gttaaattcccatagaggcaggcagatgtttatttttaaaggccagttatttcatggatccaggatactatgcatcctgataaagttcccttggcctttggaattaaaatagaccccccccacatcatcacatacccttcaccatacccccccatcatcacatgcccttcaccatacctagagattggcatggggtactttccataaaatcatctctcaatgcaaatcaaactagctattaggctaactgaaataaaaccatgccaatc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU19305 lncRNA downstream 51237 3589489 ~ 3639043 (-) True G14469
TU19243 lncRNA downstream 213898 3472937 ~ 3476382 (-) False G14426
XR_005641295.1 lncRNA downstream 279331 3402468 ~ 3410949 (-) True LOC120571770
TU19185 lncRNA downstream 461656 3228075 ~ 3228624 (-) False LOC120570817
TU19189 lncRNA downstream 564067 3116707 ~ 3126213 (-) True G14383
TU19261 lncRNA upstream 40019 3730600 ~ 3735025 (-) True G14428
TU19253 lncRNA upstream 40185 3730766 ~ 3735025 (-) False G14428
TU19254 lncRNA upstream 40185 3730766 ~ 3735025 (-) False G14428
TU19256 lncRNA upstream 40185 3730766 ~ 3735025 (-) False G14428
TU19262 lncRNA upstream 40185 3730766 ~ 3763944 (-) False G14428
XM_039819291.1 mRNA downstream 102799 3570134 ~ 3587481 (-) True LOC120570764
XM_039778725.1 mRNA downstream 132718 3472480 ~ 3557562 (-) True LOC120544862
XM_039820196.1 mRNA downstream 246342 3442448 ~ 3443938 (-) True LOC120571310
XM_039778724.1 mRNA downstream 247964 3441109 ~ 3442316 (-) True LOC120544846
XM_039778723.1 mRNA downstream 327896 3359156 ~ 3362384 (-) True LOC120544814
XM_039820140.1 mRNA upstream 49181 3739762 ~ 3791682 (-) False LOC120571265
XM_039820131.1 mRNA upstream 49181 3739762 ~ 3769396 (-) False LOC120571265
XM_039820125.1 mRNA upstream 49181 3739762 ~ 3755340 (-) True LOC120571265
XM_039778759.1 mRNA upstream 208872 3899453 ~ 4015956 (-) True LOC120544895
XM_039819729.1 mRNA upstream 231201 3921782 ~ 3923856 (-) True LOC120571031
XR_005638367.1 other downstream 297243 3392932 ~ 3393037 (-) True LOC120554328
unassigned_transcript_82 other downstream 332083 3358125 ~ 3358197 (-) True trnav-aac
XR_005638528.1 other downstream 341662 3348428 ~ 3348618 (-) True LOC120554594
XR_005638534.1 other downstream 343160 3346933 ~ 3347120 (-) True LOC120554609
XR_005638559.1 other downstream 360641 3329453 ~ 3329639 (-) True LOC120554673
TU19241 other upstream 14324 3704905 ~ 3722632 (-) True G14426
TU19429 other upstream 835959 4526540 ~ 4672863 (-) False G14552
TU19448 other upstream 835959 4526540 ~ 4577885 (-) False G14552
TU19473 other upstream 835959 4526540 ~ 4822250 (-) False G14552
TU19430 other upstream 1043668 4734249 ~ 4763971 (-) False G14552

Expression Profile


TU19318 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU19318 Expression in each Bioproject

Bar chart with 8 bars.
TU19318 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.