RNA id: TCONS_00006765


Basic Information

Item Value
RNA id TCONS_00006765
length 425
RNA type mRNA
GC content 0.50
exon number 4
gene id XLOC_003455
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 24819324 ~ 24851464 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTTCCGAGTTGACGTGTGGTACGTGCTCGTAGATATTGCTCGCATGGAATACGACGGTGGATGCTGATGAACCCTCTGCACCGAGATATGTAAAGACAAAAGTCGAGCGCGACGCCAGTACGTTTACTGCAGTTTCTACATGTCATCGTTTGGATCAAGTTCCCCAGAATGACCCATTCACGACCCAACGAGTTTATTCCACCACCGGAGTGCCCTGTCTTTGAGCCCAGTTGGGAGGAATTTGCAGACCCTTTTGGGTTCATCAACAAAATACGTCCAATTGCAGAAAACACTGGCATCTGCAAGATCCGACCGCCCCCGGGATGGCAGCCACCATTTGCCTGTGATGTGGACAGACTGCATTTTACACCGCGCATTCAGAGGCTCAATGAGTTGGAGGCTCAAACTAGAGTTAAGCTCAACT

Function

GO:

id name namespace
GO:0006338 chromatin remodeling biological_process
GO:0035097 histone methyltransferase complex cellular_component
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0032452 histone demethylase activity molecular_function
GO:0034647 histone demethylase activity (H3-trimethyl-K4 specific) molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-5379 Predicted to enable histone demethylase activity (H3-trimethyl-K4 specific). Predicted to be involved in chromatin remodeling. Predicted to act upstream of or within chromatin organization. Predicted to be active in nucleus. Is expressed in neural rod; paraxial mesoderm; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in autosomal recessive non-syndromic intellectual disability; breast cancer; and high grade glioma. Orthologous to human KDM5B (lysine demethylase 5B).

Ensembl:

ensembl_id ENSDART00000155514

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006744 lncRNA upstream 475320 24343328 ~ 24344304 (+) False XLOC_003446
TCONS_00008611 lncRNA upstream 475608 24339396 ~ 24344016 (+) False XLOC_003446
TCONS_00006743 lncRNA upstream 475608 24343010 ~ 24344016 (+) False XLOC_003446
TCONS_00006741 lncRNA upstream 476431 24340031 ~ 24343193 (+) False XLOC_003446
TCONS_00006737 lncRNA upstream 478702 24339393 ~ 24340922 (+) False XLOC_003446
TCONS_00006773 lncRNA downstream 77200 24900479 ~ 24905875 (+) False XLOC_003459
TCONS_00008401 lncRNA downstream 236183 25059462 ~ 25060098 (+) True XLOC_003463
TCONS_00008612 lncRNA downstream 358578 25181857 ~ 25189277 (+) False XLOC_003466
TCONS_00008613 lncRNA downstream 358813 25182092 ~ 25228195 (+) False XLOC_003466
TCONS_00008614 lncRNA downstream 388377 25211656 ~ 25228195 (+) False XLOC_003466
TCONS_00006762 mRNA upstream 1987 24816238 ~ 24817637 (+) False XLOC_003454
TCONS_00006760 mRNA upstream 2011 24815667 ~ 24817613 (+) False XLOC_003454
TCONS_00006761 mRNA upstream 2103 24815927 ~ 24817521 (+) False XLOC_003454
TCONS_00006763 mRNA upstream 2341 24816516 ~ 24817283 (+) True XLOC_003454
TCONS_00006759 mRNA upstream 4431 24804556 ~ 24815193 (+) False XLOC_003453
TCONS_00006767 mRNA downstream 28392 24851671 ~ 24876621 (+) True XLOC_003456
TCONS_00006768 mRNA downstream 54541 24877820 ~ 24888595 (+) False XLOC_003457
TCONS_00006770 mRNA downstream 65891 24889170 ~ 24894907 (+) True XLOC_003458
TCONS_00006771 mRNA downstream 76844 24900123 ~ 24906264 (+) False XLOC_003459
TCONS_00006772 mRNA downstream 76975 24900254 ~ 24905875 (+) False XLOC_003459
TCONS_00006746 other upstream 238510 24580579 ~ 24581114 (+) True XLOC_003447
TCONS_00006731 other upstream 474201 24339362 ~ 24345423 (+) False XLOC_003446
TCONS_00006769 other downstream 58030 24881309 ~ 24883345 (+) True XLOC_003457
TCONS_00006774 other downstream 78599 24901878 ~ 24903210 (+) True XLOC_003459
TCONS_00006779 other downstream 157640 24980919 ~ 24983498 (+) True XLOC_003460
TCONS_00006781 other downstream 171454 24994733 ~ 25025497 (+) False XLOC_003461
TCONS_00006782 other downstream 186364 25009643 ~ 25025592 (+) False XLOC_003461

Expression Profile

//