RNA id: TU281322



Basic Information


Item Value
RNA id TU281322
length 263
lncRNA type inter_gene
GC content 0.50
exon number 3
gene id G207747
representative False

Chromosome Information


Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 33150281 ~ 33254663 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


cacacacagacacacacagacacacacacacacagacacacacagagacacacacacacacacagagacacacagacacacacagagacacacacacacacacagacacacacacacagacacacacacacagagacacacacacagacacacacaccacacacagagacacaacacacagacacacacacacacacacacacacacagacacacacacacacacagagacagacacacacacacaaacacacacacacacag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU281305 lncRNA downstream 988 33094185 ~ 33149293 (-) False G207742
TU281302 lncRNA downstream 69298 33064670 ~ 33080983 (-) True G207740
TU281270 lncRNA downstream 112255 32979877 ~ 33038026 (-) True G207728
TU281283 lncRNA downstream 167557 32958695 ~ 32982724 (-) False G207728
TU281266 lncRNA downstream 227629 32920745 ~ 32922652 (-) True G207726
TU281333 lncRNA upstream 7328 33225832 ~ 33284747 (-) False G207755
TU281353 lncRNA upstream 95098 33313602 ~ 33314976 (-) True G207766
TU281355 lncRNA upstream 100448 33318952 ~ 33362302 (-) True G207767
TU281356 lncRNA upstream 102280 33320784 ~ 33323023 (-) True G207768
TU281373 lncRNA upstream 147893 33366397 ~ 33446959 (-) False G207776
XM_039785450.1 mRNA downstream 71962 32994358 ~ 33078319 (-) True prkd1
XM_039785449.1 mRNA downstream 186232 32961278 ~ 32964049 (-) True LOC120548945
XM_039785448.1 mRNA downstream 218271 32859559 ~ 32932010 (-) True LOC120548944
XM_039786993.1 mRNA downstream 459368 32687730 ~ 32690913 (-) True LOC120549825
XM_039786621.1 mRNA downstream 468379 32673953 ~ 32681902 (-) True LOC120549602
XM_039785015.1 mRNA upstream 85247 33303751 ~ 33305439 (-) True foxg1a
XM_039785451.1 mRNA upstream 105103 33323607 ~ 33460847 (-) True sptbn5
XM_039785993.1 mRNA upstream 290104 33508608 ~ 33524752 (-) True LOC120549249
XM_039785994.1 mRNA upstream 313983 33532487 ~ 33581461 (-) True ehd4
XM_039785129.1 mRNA upstream 375564 33594068 ~ 33623644 (-) True coch
TU281304 other downstream 988 33118888 ~ 33149293 (-) False G207742
TU281307 other downstream 988 33118888 ~ 33149293 (-) False G207742
TU281306 other downstream 988 33148146 ~ 33149293 (-) True G207742
TU281303 other downstream 79554 33070261 ~ 33070727 (-) True G207741
TU281288 other downstream 138041 32994412 ~ 33012240 (-) False prkd1
TU281405 other upstream 273069 33491573 ~ 33498532 (-) True G207802
TU281412 other upstream 314973 33533477 ~ 33611751 (-) True G207808
TU281419 other upstream 362520 33581024 ~ 33647324 (-) False ehd4
TU281464 other upstream 500981 33719485 ~ 33731941 (-) False g2e3
TU281431 other upstream 553873 33772377 ~ 33846497 (-) False strn3

Expression Profile


TU281322 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU281322 Expression in each Bioproject

Bar chart with 4 bars.
TU281322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.