RNA id: TU281429



Basic Information


Item Value
RNA id TU281429
length 432
lncRNA type sense_over
GC content 0.52
exon number 2
gene id scfd1
representative False

Chromosome Information


Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 33632979 ~ 33702742 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


CTCTTTAATTGTCTACCTCCTTGGTCTCTGGAAACTGCTGCGGAGTGATACCTCTTTAATTTTCTACCTCCTTGGTCTCTGGAAACTGCGGCGGAGTGATACCTCTTTAATTTTCTACCTCCTTGGTCTCTGGAAACTGCTGCGGAGTGATACCTCTTTAATTTTCTACCTCCTTGGTCTCTGGAACCTGCGGCGGAGTGATACCTCTTTAATTTTCTACCTCCTTGGTCTCTGGAACCTGCGGCGGAGTGATACCTCTTCGTTCTTTCCGCCTCTCTGACGGGCTGCGGCCACGTCATCAGACGCTCCGTCACCAACAACATCCAACATGGCGGCGTCTGTCCGGGAGAAGCAGACAGTCGCTCTGAAGCGAATGCTGAACTTCAACGCTCCTCCTCTGAAGAACACAGCAGCGGAGCCAGTATGGAAGGT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU281425 lncRNA downstream 12260 33685572 ~ 33686916 (-) True G207817
TU281404 lncRNA downstream 16112 33646701 ~ 33683064 (-) True G207801
TU281395 lncRNA downstream 19339 33674913 ~ 33679837 (-) False scfd1
TU281415 lncRNA downstream 127743 33549763 ~ 33571433 (-) True G207809
TU281394 lncRNA downstream 210756 33478983 ~ 33488420 (-) True G207794
TU281455 lncRNA upstream 2238 33704980 ~ 33705588 (-) True G207824
TU281458 lncRNA upstream 4427 33707169 ~ 33709487 (-) True G207826
TU281460 lncRNA upstream 8250 33710992 ~ 33711616 (-) True G207828
TU281462 lncRNA upstream 8250 33710992 ~ 33711616 (-) False G207828
TU281463 lncRNA upstream 8250 33710992 ~ 33711298 (-) False G207828
XM_039785129.1 mRNA downstream 75532 33594068 ~ 33623644 (-) True coch
XM_039785994.1 mRNA downstream 117715 33532487 ~ 33581461 (-) True ehd4
XM_039785993.1 mRNA downstream 174424 33508608 ~ 33524752 (-) True LOC120549249
XM_039785451.1 mRNA downstream 238329 33323607 ~ 33460847 (-) True sptbn5
XM_039785015.1 mRNA downstream 393737 33303751 ~ 33305439 (-) True foxg1a
XM_039785094.1 mRNA upstream 7121 33709863 ~ 33731941 (-) True g2e3
XM_039785454.1 mRNA upstream 69597 33772339 ~ 33818299 (-) False strn3
XM_039785456.1 mRNA upstream 128445 33831187 ~ 33904023 (-) True hectd1
XM_039786103.1 mRNA upstream 218104 33920846 ~ 33924487 (-) True LOC120549293
XM_039785457.1 mRNA upstream 317067 34019809 ~ 34052414 (-) True LOC120548953
TU281419 other downstream 51852 33581024 ~ 33647324 (-) False ehd4
TU281412 other downstream 87425 33533477 ~ 33611751 (-) True G207808
TU281405 other downstream 200644 33491573 ~ 33498532 (-) True G207802
TU281307 other downstream 549883 33118888 ~ 33149293 (-) False G207742
TU281464 other upstream 16743 33719485 ~ 33731941 (-) False g2e3
TU281431 other upstream 69635 33772377 ~ 33846497 (-) False strn3
TU281435 other upstream 69635 33772377 ~ 33884726 (-) False strn3
TU281436 other upstream 69635 33772377 ~ 33846497 (-) False strn3
TU281439 other upstream 69635 33772377 ~ 33777317 (-) False strn3

Expression Profile


TU281429 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU281429 Expression in each Bioproject

Bar chart with 2 bars.
TU281429 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.