RNA id: TU311715



Basic Information


Item Value
RNA id TU311715
length 285
lncRNA type inter_gene
GC content 0.49
exon number 2
gene id G229784
representative True

Chromosome Information


Item Value
chromosome id NC_053134.1
NCBI id CM020931.1
chromosome length 29109922
location 23285567 ~ 23286896 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


gttgagggcggctgcactgtaacctgactgtaaccaagtttatatatccccgcgccgtttatagctttattataagtatatgtcaacaatgtgcacagaatggtcgacgcactttcacctgcacccgtcaggaaacgggagaaagctttgaagtgggacgtatgaagttatgtccacaactacgagggtgtgacttaagtacccgttgagctgcatcacagctgcactatgtgcatggacctgtgccagtcagaacatcactcacctgtgtgcagaggacaggcg

Function


GO: NA

KEGG:

id description
ko00140 Steroid hormone biosynthesis

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU311713 lncRNA downstream 1516 23283529 ~ 23284051 (-) True G229782
TU311697 lncRNA downstream 76511 23203768 ~ 23209056 (-) True glipr1a
TU311672 lncRNA downstream 165138 23046595 ~ 23120429 (-) True G229748
XR_005638088.1 lncRNA downstream 199973 23084579 ~ 23085594 (-) True LOC120553038
TU311505 lncRNA downstream 425156 22860118 ~ 22860411 (-) True G229626
TU311705 lncRNA upstream 11813 23298709 ~ 23313086 (-) True G229774
TU311733 lncRNA upstream 126220 23413116 ~ 23413758 (-) True G229802
TU311805 lncRNA upstream 240209 23527105 ~ 23527539 (-) True G229867
TU311811 lncRNA upstream 251352 23538248 ~ 23560342 (-) True G229872
XR_005638123.1 lncRNA upstream 336684 23623580 ~ 23641504 (-) True LOC120553168
XM_039791006.1 mRNA downstream 10024 23229083 ~ 23275543 (-) True cmah
XM_039791993.1 mRNA downstream 75070 23205434 ~ 23210497 (-) False glipr1a
XM_039792151.1 mRNA downstream 97805 23177186 ~ 23187762 (-) False LOC120553577
XM_039791651.1 mRNA upstream 242861 23529757 ~ 23531807 (-) True phax
XM_039791654.1 mRNA upstream 275264 23562160 ~ 23588760 (-) True dnajc2
XM_039791653.1 mRNA upstream 307456 23594352 ~ 23617076 (-) False slc26a5
XM_039791652.1 mRNA upstream 307456 23594352 ~ 23617075 (-) True slc26a5
XM_039791277.1 mRNA upstream 390272 23677168 ~ 23684068 (-) True cbll1
TU311637 other downstream 45994 23104760 ~ 23239573 (-) True G229716
TU311319 other downstream 1474470 21771136 ~ 21811097 (-) False LOC120553090
TU311312 other downstream 1474536 21771088 ~ 21811031 (-) False LOC120553090
XR_005638087.1 other downstream 2140034 21063691 ~ 21145533 (-) False ptprz1b
TU310933 other downstream 2327347 20957657 ~ 20958220 (-) True G229199
TU311825 other upstream 405125 23692021 ~ 23711795 (-) True LOC120553170
TU311851 other upstream 412801 23699697 ~ 23700198 (-) True G229907
TU311926 other upstream 621660 23908556 ~ 23914692 (-) True G229950
TU311924 other upstream 625205 23912101 ~ 23914692 (-) False G229950
unassigned_transcript_1528 other upstream 1290054 24576950 ~ 24577021 (-) True trnap-agg_20

Expression Profile


TU311715 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU311715 Expression in each Bioproject

Bar chart with 3 bars.
TU311715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.