RNA id: TCONS_00073027


Basic Information

Item Value
RNA id TCONS_00073027
length 623
lncRNA type retained_intron
GC content 0.48
exon number 2
gene id XLOC_037097
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 21993092 ~ 21994057 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATCATGAGTTGTTATAGTGGTGTTGACTTTATCTAATGGCTATGTGTTTTTACCATTGCTATAGATTATCTTTTATGAAGATAGGAACTTCGGTGGCCGTTACCATGAGTGCATGAGTGACTGCGCTGACCTGCATTCCTACTTCAACCGCTGCCACTCTATCAGAGTGGAAAGCGGTTGCTTCATGGTCTACGACCGCACCAACTTTATGGGCCGTCAGTACTTTTTGAGACGTGGCGAATACCCTGATTACATGCGTACTATGGGAATGAATGATTGTGTCAGATCCTGTCGGATGATTCCACTGCACCATGGGTCCTTCAAAATGAGGCTCTACGAGCATTCAGACATGGGTGGCAGGATGATGGAGCTCATGGATGATTGCCCCAATCTCATGGATCGCTTCAACATGTCCGACTTCCATTCCTGTCATGTGATGGATGGGCATTGGCTCGTGTATGAGCAGCCCAACTATACGGGCAGGCAGTTCTACCTGAGGCCTGGCGAGTACAGGAGTTACAATGACTGGGGTGGTGTGACTTCCAGGATGGGCTCCATTAGACGAATCACGGATCTCTAATGAAAGGAGTCCTTGTGAAATGTCTCCTGTATGCCCTTTTTCA

Function

GO:

id name namespace
GO:0002088 lens development in camera-type eye biological_process
GO:0007601 visual perception biological_process
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050516-8 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in lens. Human ortholog(s) of this gene implicated in cataract; cataract 2 multiple types; cataract 39 multiple types; cataract 4 multiple types; and cataract 7. Orthologous to several human genes including CRYGA (crystallin gamma A); CRYGB (crystallin gamma B); and CRYGC (crystallin gamma C).

Ensembl:

ensembl_id ENSDART00000145297

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073017 lncRNA upstream 163444 21826734 ~ 21829744 (+) True XLOC_037092
TCONS_00073011 lncRNA upstream 190228 21802075 ~ 21802960 (+) True XLOC_037090
TCONS_00075100 lncRNA upstream 227453 21762019 ~ 21765735 (+) True XLOC_037089
TCONS_00074895 lncRNA upstream 230219 21761696 ~ 21762969 (+) False XLOC_037089
TCONS_00075099 lncRNA upstream 237278 21719774 ~ 21755910 (+) True XLOC_037087
TCONS_00075101 lncRNA downstream 318842 22312733 ~ 22313617 (+) False XLOC_037104
TCONS_00075102 lncRNA downstream 319004 22312895 ~ 22313617 (+) False XLOC_037104
TCONS_00075103 lncRNA downstream 319038 22312929 ~ 22313617 (+) True XLOC_037104
TCONS_00073038 lncRNA downstream 366071 22359962 ~ 22360742 (+) True XLOC_037106
TCONS_00074896 lncRNA downstream 648495 22642386 ~ 22642685 (+) True XLOC_037110
TCONS_00073023 mRNA upstream 1972 21990095 ~ 21991216 (+) False XLOC_037096
TCONS_00073024 mRNA upstream 1988 21990136 ~ 21991200 (+) True XLOC_037096
TCONS_00073022 mRNA upstream 2068 21990095 ~ 21991120 (+) False XLOC_037096
TCONS_00073019 mRNA upstream 9529 21977383 ~ 21983659 (+) True XLOC_037094
TCONS_00073018 mRNA upstream 147405 21843915 ~ 21845783 (+) True XLOC_037093
TCONS_00073028 mRNA downstream 2424 21996315 ~ 21997115 (+) False XLOC_037098
TCONS_00073029 mRNA downstream 2570 21996461 ~ 21997149 (+) True XLOC_037098
TCONS_00073030 mRNA downstream 6921 22000812 ~ 22001778 (+) True XLOC_037099
TCONS_00073031 mRNA downstream 10051 22003942 ~ 22004833 (+) True XLOC_037100
TCONS_00073032 mRNA downstream 18021 22011912 ~ 22012819 (+) True XLOC_037101
TCONS_00073021 other upstream 1976 21990058 ~ 21991212 (+) False XLOC_037096
TCONS_00073020 other upstream 7192 21984109 ~ 21985996 (+) True XLOC_037095
TCONS_00073007 other upstream 281042 21571433 ~ 21712146 (+) False XLOC_037087
TCONS_00073005 other upstream 433403 21540853 ~ 21559785 (+) False XLOC_037087
TCONS_00072979 other upstream 767056 21214940 ~ 21226132 (+) True XLOC_037078
TCONS_00073045 other downstream 397675 22391566 ~ 22447578 (+) False XLOC_037107
TCONS_00073048 other downstream 583054 22576945 ~ 22577059 (+) True XLOC_037108
TCONS_00073057 other downstream 664338 22658229 ~ 22662728 (+) True XLOC_037111
TCONS_00073071 other downstream 1012560 23006451 ~ 23006978 (+) True XLOC_037117
TCONS_00073073 other downstream 1052376 23046267 ~ 23046385 (+) True XLOC_037119