RNA id: TCONS_00073413


Basic Information

Item Value
RNA id TCONS_00073413
length 814
RNA type mRNA
GC content 0.49
exon number 4
gene id XLOC_037304
representative False

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 35843732 ~ 35865528 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAGAATAGAGCATTCCAGAAGATTCTGCCTCAGCTGAAGCAGCATCACGTGACCACAATACGAGGACGTTACTCAACCTGACCCATTTCCTTTCTGAAAGCCCCGAAGGCTCTCTGCTGGATTGACAACGTCTGAGAGAAGGAGGAAGAAAAGGAGCAGTGAAGAGGGTGTTTTTGAAGCATTTGTTTCCTGAAGCAGGCGTCATTTGTGTCCTCACGCTGGGGAAGGCAAAACGGACACGTCTCAACCCCTCCTGCCCTTTACATTCTTTAACCTCTCAAGTCCTCCGGAGGATCCGTCAACGGGCTTCAGTCATGCACCTGAAAACAATGAAGTGCAACCCTTTCTGCCTTATCGCTTCCTTAGAGGATCCGGACATGTTTAACAGTCCTGTGGAGATGGCAGGATTTGAGGATCTTTTCCGTGCCTTTGACCGAAATGTCACTTTCCAGTTCTTCAAGAGTTTCCGTCGGGTGAGGATTAATTTCACCAATGCTTTGGCCGCTGCAGAGGCAAGAGCAAAACTCCACAAAAGTGACTTCAATGGCAGAGAGTTACGACTCTATTTTGCACAGTCTGTCCACATTGGCAGTCCACACCTGGAACCTCCTAAACCAGATAAACAGTTCCTCCTTTCCCCTCCGCCATCACCTCCTGTGGGTTGGGAGCAGGCAAAAGACGCCACGCCCGTCATTAACTATGACCTCCTGTGTGCCATCGCTAGACTAGGGCCAGGTGAAAAATATGAACTCCAACCAGGAACTCCGACCACTCCAAGTGTGGTTGTTCATGTTTGTGACAATGATCAAGAAAG

Function

GO:

id name namespace
GO:0033173 calcineurin-NFAT signaling cascade biological_process
GO:0002040 sprouting angiogenesis biological_process
GO:0070884 regulation of calcineurin-NFAT signaling cascade biological_process
GO:0019722 calcium-mediated signaling biological_process
GO:0005737 cytoplasm cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0008597 calcium-dependent protein serine/threonine phosphatase regulator activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040801-135 Predicted to enable calcium-dependent protein serine/threonine phosphatase regulator activity. Acts upstream of or within sprouting angiogenesis. Predicted to be active in cytoplasm and nucleus. Is expressed in brain; cardiac ventricle; heart; heart tube; and yolk syncytial layer. Human ortholog(s) of this gene implicated in Alzheimer's disease. Orthologous to human RCAN1 (regulator of calcineurin 1).

Ensembl:

ensembl_id ENSDART00000134447

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00075169 lncRNA upstream 693041 35160698 ~ 35167934 (+) True XLOC_037301
TCONS_00075168 lncRNA upstream 697311 35160644 ~ 35163664 (+) False XLOC_037301
TCONS_00075167 lncRNA upstream 778979 35077550 ~ 35081996 (+) False XLOC_037300
TCONS_00073408 lncRNA upstream 779745 35079570 ~ 35081230 (+) True XLOC_037300
TCONS_00073406 lncRNA upstream 830868 35026304 ~ 35030107 (+) True XLOC_037299
TCONS_00075170 lncRNA downstream 124272 35987844 ~ 36102672 (+) True XLOC_037307
TCONS_00075171 lncRNA downstream 261181 36124753 ~ 36177421 (+) True XLOC_037308
TCONS_00075172 lncRNA downstream 907092 36770664 ~ 36775514 (+) True XLOC_037310
TCONS_00075173 lncRNA downstream 1064483 36928055 ~ 36930192 (+) False XLOC_037312
TCONS_00075174 lncRNA downstream 1064483 36928055 ~ 36932532 (+) True XLOC_037312
TCONS_00073410 mRNA upstream 18600 35832294 ~ 35842375 (+) False XLOC_037303
TCONS_00073411 mRNA upstream 24801 35832370 ~ 35836174 (+) True XLOC_037303
TCONS_00073407 mRNA upstream 778994 35077546 ~ 35081981 (+) False XLOC_037300
TCONS_00073404 mRNA upstream 834367 35017702 ~ 35026608 (+) False XLOC_037299
TCONS_00073403 mRNA upstream 835858 35016201 ~ 35025117 (+) False XLOC_037299
TCONS_00073416 mRNA downstream 13355 35876927 ~ 35885260 (+) True XLOC_037305
TCONS_00073417 mRNA downstream 37982 35901554 ~ 35922201 (+) True XLOC_037306
TCONS_00073418 mRNA downstream 451295 36314867 ~ 36694998 (+) False XLOC_037309
TCONS_00073419 mRNA downstream 493168 36356740 ~ 36694998 (+) True XLOC_037309
TCONS_00073424 mRNA downstream 1082768 36946340 ~ 36956667 (+) True XLOC_037313
TCONS_00073409 other upstream 431659 35429202 ~ 35429316 (+) True XLOC_037302
TCONS_00073405 other upstream 838661 35017847 ~ 35022314 (+) False XLOC_037299
TCONS_00073397 other upstream 891408 34969450 ~ 34969567 (+) True XLOC_037296
TCONS_00073390 other upstream 1070088 34790750 ~ 34790887 (+) True XLOC_037293
TCONS_00073386 other upstream 1431755 34426291 ~ 34429220 (+) True XLOC_037290
TCONS_00073420 other downstream 930812 36794384 ~ 36795322 (+) False XLOC_037311
TCONS_00073421 other downstream 931147 36794719 ~ 36797775 (+) False XLOC_037311
TCONS_00073422 other downstream 931147 36794719 ~ 36797828 (+) False XLOC_037311
TCONS_00073423 other downstream 931147 36794719 ~ 36797834 (+) True XLOC_037311
TCONS_00073428 other downstream 1317868 37181440 ~ 37181557 (+) True XLOC_037317

Expression Profile

//