RNA id: TCONS_00073450



Basic Information


Item Value
RNA id TCONS_00073450
length 190
RNA type mRNA
GC content 0.56
exon number 3
gene id XLOC_037332
representative False

Chromosome Information


Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 38163876 ~ 38291809 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CCAAACTCCTGCATAATCATCTCAAGAACTCTAGCAACACCAGCAACGTGAGTTCACCAAGCAATACAATGGGCCGCACACCAGCCCGGCACCCCACCAGCAGGACTAGTCCACTCACCTCACCCACAAACTGCTCTCATGGAGGTCTTTCGCCCAGTCGGTTGTGGGGTTGGGGTGTCGATGGGCTCTT

Function


GO:

id name namespace
GO:0090307 mitotic spindle assembly biological_process
GO:0040001 establishment of mitotic spindle localization biological_process
GO:0031110 regulation of microtubule polymerization or depolymerization biological_process
GO:0000226 microtubule cytoskeleton organization biological_process
GO:0000776 kinetochore cellular_component
GO:0072686 mitotic spindle cellular_component
GO:0005815 microtubule organizing center cellular_component
GO:0005828 kinetochore microtubule cellular_component
GO:0045180 basal cortex cellular_component
GO:0005876 spindle microtubule cellular_component
GO:0005881 cytoplasmic microtubule cellular_component
GO:0051010 microtubule plus-end binding molecular_function
GO:0008017 microtubule binding molecular_function
GO:0043515 kinetochore binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-081104-520 Predicted to enable kinetochore binding activity and microtubule binding activity. Predicted to be involved in establishment of mitotic spindle localization and mitotic spindle assembly. Predicted to be located in Golgi apparatus; chromosome, centromeric region; and kinetochore microtubule. Predicted to be active in basal cortex; kinetochore; and microtubule cytoskeleton. Orthologous to human CLASP1 (cytoplasmic linker associated protein 1).

Ensembl:

ensembl_id ENSDART00000142853

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00073443 lncRNA upstream 112026 38158600 ~ 38161207 (+) False XLOC_037329
TCONS_00075178 lncRNA upstream 249172 38021890 ~ 38024061 (+) True XLOC_037326
TCONS_00075177 lncRNA upstream 764960 37506959 ~ 37508273 (+) True XLOC_037322
TCONS_00075176 lncRNA upstream 780319 37475147 ~ 37492914 (+) True XLOC_037321
TCONS_00075175 lncRNA upstream 1281382 36991163 ~ 36991851 (+) True XLOC_037315
TCONS_00073452 lncRNA downstream 16458 38292919 ~ 38296930 (+) False XLOC_037333
TCONS_00073455 lncRNA downstream 31225 38307686 ~ 38308570 (+) True XLOC_037333
TCONS_00073462 lncRNA downstream 136287 38412748 ~ 38418111 (+) True XLOC_037337
TCONS_00073463 lncRNA downstream 143551 38420012 ~ 38421036 (+) False XLOC_037338
TCONS_00073469 lncRNA downstream 193580 38470041 ~ 38470807 (+) False XLOC_037341
TCONS_00073442 mRNA upstream 111138 38158570 ~ 38162095 (+) False XLOC_037329
TCONS_00073444 mRNA upstream 112167 38158603 ~ 38161066 (+) False XLOC_037329
TCONS_00073439 mRNA upstream 143148 38074082 ~ 38130085 (+) False XLOC_037328
TCONS_00073441 mRNA upstream 143874 38088331 ~ 38129359 (+) True XLOC_037328
TCONS_00073440 mRNA upstream 143888 38075851 ~ 38129345 (+) False XLOC_037328
TCONS_00073454 mRNA downstream 16486 38292947 ~ 38311750 (+) False XLOC_037333
TCONS_00073456 mRNA downstream 38005 38314466 ~ 38352220 (+) True XLOC_037334
TCONS_00073457 mRNA downstream 93411 38369872 ~ 38390990 (+) False XLOC_037335
TCONS_00073458 mRNA downstream 95755 38372216 ~ 38388864 (+) True XLOC_037335
TCONS_00073459 mRNA downstream 123451 38399912 ~ 38407176 (+) False XLOC_037336
TCONS_00073445 other upstream 111584 38158798 ~ 38161649 (+) True XLOC_037329
TCONS_00073447 other upstream 111844 38161263 ~ 38161389 (+) True XLOC_037331
TCONS_00073446 other upstream 112661 38160446 ~ 38160572 (+) True XLOC_037330
TCONS_00073437 other upstream 395683 37877434 ~ 37877550 (+) True XLOC_037325
TCONS_00073432 other upstream 861247 37411870 ~ 37411986 (+) True XLOC_037320
TCONS_00073451 other downstream 2922 38279383 ~ 38286788 (+) True XLOC_037332
TCONS_00073453 other downstream 16486 38292947 ~ 38311747 (+) False XLOC_037333
TCONS_00073484 other downstream 408410 38684871 ~ 38707510 (+) False XLOC_037347
TCONS_00073487 other downstream 461151 38737612 ~ 38744774 (+) False XLOC_037348
TCONS_00073489 other downstream 510467 38786928 ~ 38787044 (+) True XLOC_037349

Expression Profile


//