RNA id: TCONS_00073495


Basic Information

Item Value
RNA id TCONS_00073495
length 505
RNA type mRNA
GC content 0.59
exon number 3
gene id XLOC_037350
representative False

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 38883388 ~ 38993033 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TAAAAGGAGCCAGTTGGTCGAGACAGATCTTTATGAGCTCCGGCCTGCTTCAGCCGGCCCACAAGTATCAATAAATATATATCATGTAAAGGATGGTCGTTCTCGGAGCCCAGAGAAGAGGTCATCTTTGCCCCGTCCTGCATCCATACTAACCCGCCGCTCACACATGGCTGAGCATGAGGAGAGCTCCACTTCCATTACCAGCTCTGGGTCTACCGCACCACGCAGACCCACATGCACAGAGTCAGGTCGGTCCCGCTCTGCCCGCAGCGGCACCTCCACACCCCACACACCCGGCTCAACAGCCATCACCCCTGGCACCCCTCCCAGCTATTCCTGCCGCACCCCGGGCACACCTCGCACCCCAGGGACCCCTAAATCCCTCAGCTTGCTGTCCCAGGAGAAGAAAGTGGCTATCATCCGCACCCCTCCGAAATCTCCGGCTACCACACCCAAACAGCTGCGCGTCCTGAACCAGCCACTGCCCGACCTCAAGAACATCAGA

Function

GO:

id name namespace
GO:0001578 microtubule bundle formation biological_process
GO:0021954 central nervous system neuron development biological_process
GO:0000226 microtubule cytoskeleton organization biological_process
GO:0031175 neuron projection development biological_process
GO:0043005 neuron projection cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005874 microtubule cellular_component
GO:0005737 cytoplasm cellular_component
GO:0015631 tubulin binding molecular_function
GO:0008017 microtubule binding molecular_function

KEGG:

id description
ko04812 Cytoskeleton proteins

ZFIN:

id description
ZDB-GENE-041010-118 Predicted to enable microtubule binding activity. Predicted to be involved in microtubule cytoskeleton organization and neuron projection development. Predicted to act upstream of or within central nervous system neuron development and microtubule bundle formation. Predicted to be located in cytoplasm and microtubule. Predicted to be active in neuron projection. Is expressed in brain and central nervous system. Orthologous to human MAP2 (microtubule associated protein 2).

Ensembl:

ensembl_id ENSDART00000135581

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073476 lncRNA upstream 349667 38615603 ~ 38618331 (+) True XLOC_037344
TCONS_00073469 lncRNA upstream 497191 38470041 ~ 38470807 (+) False XLOC_037341
TCONS_00073463 lncRNA upstream 546962 38420012 ~ 38421036 (+) False XLOC_037338
TCONS_00073462 lncRNA upstream 549887 38412748 ~ 38418111 (+) True XLOC_037337
TCONS_00073455 lncRNA upstream 659428 38307686 ~ 38308570 (+) True XLOC_037333
TCONS_00074931 lncRNA downstream 888225 39863253 ~ 39865672 (+) True XLOC_037353
TCONS_00073518 lncRNA downstream 2105066 41080094 ~ 41083181 (+) False XLOC_037363
TCONS_00073517 lncRNA downstream 2105066 41080094 ~ 41083181 (+) True XLOC_037363
TCONS_00073527 lncRNA downstream 2263213 41238241 ~ 41240872 (+) False XLOC_037366
TCONS_00075179 lncRNA downstream 2263213 41238241 ~ 41246508 (+) False XLOC_037366
TCONS_00073490 mRNA upstream 8802 38883388 ~ 38959196 (+) False XLOC_037350
TCONS_00073486 mRNA upstream 193595 38712474 ~ 38774403 (+) False XLOC_037348
TCONS_00073488 mRNA upstream 196271 38737924 ~ 38771727 (+) True XLOC_037348
TCONS_00073485 mRNA upstream 260488 38684871 ~ 38707510 (+) False XLOC_037347
TCONS_00073496 mRNA downstream 8867 38983895 ~ 38991366 (+) True XLOC_037350
TCONS_00073500 mRNA downstream 51283 39026311 ~ 39139722 (+) False XLOC_037352
TCONS_00073501 mRNA downstream 52095 39027123 ~ 39136765 (+) False XLOC_037352
TCONS_00073502 mRNA downstream 52284 39027312 ~ 39136845 (+) False XLOC_037352
TCONS_00073503 mRNA downstream 52284 39027312 ~ 39138504 (+) True XLOC_037352
TCONS_00073489 other upstream 180954 38786928 ~ 38787044 (+) True XLOC_037349
TCONS_00073487 other upstream 223224 38737612 ~ 38744774 (+) False XLOC_037348
TCONS_00073484 other upstream 260488 38684871 ~ 38707510 (+) False XLOC_037347
TCONS_00073453 other upstream 656251 38292947 ~ 38311747 (+) False XLOC_037333
TCONS_00073451 other upstream 681210 38279383 ~ 38286788 (+) True XLOC_037332
TCONS_00073497 other downstream 35404 39010432 ~ 39011384 (+) False XLOC_037351
TCONS_00073498 other downstream 35417 39010445 ~ 39014598 (+) False XLOC_037351
TCONS_00073499 other downstream 36198 39011226 ~ 39013435 (+) True XLOC_037351
TCONS_00073504 other downstream 1162469 40137497 ~ 40137612 (+) True XLOC_037354
TCONS_00073505 other downstream 1303119 40278147 ~ 40278263 (+) True XLOC_037355

Expression Profile

//