RNA id: TCONS_00073552


Basic Information

Item Value
RNA id TCONS_00073552
length 780
RNA type nonsense_mediated_decay
GC content 0.54
exon number 7
gene id XLOC_037378
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 42040557 ~ 42127228 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATATAATCAACTCCATGAGCAACAGTCCAGCCACCAGTAAACCTCCGGTCACTCTGCGTCTCGTGGTGCCCGCCAGTCAGTGTGGCTCCCTCATCGGCAAAGGAGGATCCAAAATCAAAGAGATGAGAGAGTCCACAGGAGCTCAGGTGCAGGTAGCAGGAGACATGCTGCCCAACTCCACAGAGCGCGCAGTGACAATCTCCGGCACCCCGGAAGCCATCATCCAGTGTGTCAAACAGATATGTGTGGTCATGCTGGAGTCCCCACCGAAAGGTGCCACCATTCCCTACCGCCCAAAGCCCGCCTCCACCCCCGTCATTTTTTCAGGTGGCCAGGTAAGAGCCGACCCGCTGGCGGCGTCCGCAGCAAACCTCAGCCTTTTACTGCAGCACCAGCCACTGCCTGCCTACACAATTCAGGGACAATATGCCATTCCACACCCAGATGTCTGGATGCCAGTCCCCCGGCCAGTACTCATGAACTCACCATTCCCAATGATCTAATAGGCTGCATAATCGGGCGCCAGGGAACCAAAATCAACGAGATCCGTCAGATGTCTGGAGCTCAGATCAAAATAGCTAATGCCATGGAAGGGTCATCAGAGCGCCAGATCACCATTACAGGAACCCCCGCCAACATCAGCCTTGCCCAGTACCTCATCAACGCAAGGTTCAGAGACGTGGCAGCCATGTGGAATGACCCCTCATCAATGACTACATCCTGAAGCCCCAAACTGCTTTCATTACATGAAGCTCTGAGCAGCTGATTCCCAATATACA

Function

GO:

id name namespace
GO:0051252 regulation of RNA metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-157 Predicted to enable mRNA binding activity. Predicted to be involved in regulation of RNA metabolic process and regulation of gene expression. Predicted to be active in cytoplasm and nucleus. Is expressed in several structures, including brain; otic vesicle; pleuroperitoneal region; retina; and tail bud. Orthologous to human PCBP3 (poly(rC) binding protein 3).

Ensembl:

ensembl_id ENSDART00000144448

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073541 lncRNA upstream 293382 41788217 ~ 41806355 (+) True XLOC_037375
TCONS_00073535 lncRNA upstream 500910 41509948 ~ 41598827 (+) True XLOC_037369
TCONS_00073534 lncRNA upstream 520735 41509948 ~ 41579002 (+) False XLOC_037369
TCONS_00073533 lncRNA upstream 620351 41474942 ~ 41479386 (+) True XLOC_037368
TCONS_00073528 lncRNA upstream 853229 41240768 ~ 41246508 (+) True XLOC_037366
TCONS_00074932 lncRNA downstream 32992 42158376 ~ 42158616 (+) True XLOC_037381
TCONS_00075181 lncRNA downstream 223574 42348958 ~ 42500284 (+) False XLOC_037383
TCONS_00075182 lncRNA downstream 332715 42458099 ~ 42500284 (+) False XLOC_037383
TCONS_00075183 lncRNA downstream 332747 42458131 ~ 42500284 (+) False XLOC_037383
TCONS_00075184 lncRNA downstream 366041 42491425 ~ 42500284 (+) False XLOC_037383
TCONS_00073542 mRNA upstream 120232 41821613 ~ 41979505 (+) False XLOC_037376
TCONS_00073544 mRNA upstream 120232 41914378 ~ 41979505 (+) False XLOC_037376
TCONS_00073543 mRNA upstream 120232 41914378 ~ 41979505 (+) True XLOC_037376
TCONS_00073539 mRNA upstream 358317 41690153 ~ 41741420 (+) True XLOC_037373
TCONS_00073537 mRNA upstream 418684 41612642 ~ 41681053 (+) True XLOC_037371
TCONS_00073553 mRNA downstream 32194 42157578 ~ 42164744 (+) True XLOC_037380
TCONS_00073554 mRNA downstream 143675 42269059 ~ 42270733 (+) False XLOC_037382
TCONS_00073555 mRNA downstream 144659 42270043 ~ 42270960 (+) True XLOC_037382
TCONS_00073556 mRNA downstream 421120 42546504 ~ 42650623 (+) False XLOC_037384
TCONS_00073557 mRNA downstream 481297 42606681 ~ 42650623 (+) False XLOC_037384
TCONS_00073546 other upstream 4560 42040557 ~ 42095177 (+) False XLOC_037378
TCONS_00073545 other upstream 61418 41990086 ~ 42038319 (+) True XLOC_037377
TCONS_00073540 other upstream 366127 41733533 ~ 41733610 (+) True XLOC_037374
TCONS_00073538 other upstream 416727 41682926 ~ 41683010 (+) True XLOC_037372
TCONS_00073536 other upstream 506127 41593496 ~ 41593610 (+) True XLOC_037370
TCONS_00073560 other downstream 1206011 43331395 ~ 43331511 (+) True XLOC_037386
TCONS_00073561 other downstream 1649867 43775251 ~ 43775365 (+) True XLOC_037387
TCONS_00073566 other downstream 1730111 43855495 ~ 43855610 (+) True XLOC_037389
TCONS_00073582 other downstream 2806791 44932175 ~ 44932293 (+) True XLOC_037397
TCONS_00073585 other downstream 2870885 44996269 ~ 44997423 (+) True XLOC_037398

Expression Profile

//