RNA id: TCONS_00073574


Basic Information

Item Value
RNA id TCONS_00073574
length 501
lncRNA type retained_intron
GC content 0.53
exon number 5
gene id XLOC_037393
representative False

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 44430705 ~ 44489978 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCAGTCGGAGAACTCACACTGAGAAAAACCTGCAGTCATCTCTGCCGCTGGGACGTTTATGGGACACTGCGAAGAAGGCGGGATATACAGGAGGGAGAGGAAATCACTGATAAATAGGGTCCAGTTAGTCTCCATCTCTCTCCGACAGTTCTCTCGTTCAGCATGGAGCCCAACAGCCCCAAGAAGATTCAGTTTGCCGTTCCACTTTTCCAGAGCCAGTTGGATCCCCAGGCGGCCGAGCATATTCGCAAGCGCAGACCTACTCCAGCCACACTGGTCATTTACAATGAGCCCAGTGCCTCAGGAGATGACAAGCAGTCTACAGGCCATCAAACAGAGGCCCAGAACGCGCAGCTTTCTCCAGCCCAGAGGAAACAGAGCGTCTACACACCGCCCACCATGAGAGGTAAAGATCCAGCATCTGCACTGATGTGACGTTTCTGACTCTTGCGTAACCAGAGCATCTGACTCACTCCTCTTATGCAGTACTTCATGAGCTGG

Function

GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process
GO:0007165 signal transduction biological_process
GO:0005737 cytoplasm cellular_component
GO:0004864 protein phosphatase inhibitor activity molecular_function

KEGG:

id description
ko01009 Protein phosphatases and associated proteins

ZFIN:

id description
ZDB-GENE-040718-273 Predicted to enable protein phosphatase inhibitor activity. Predicted to be involved in intracellular signal transduction. Predicted to act upstream of or within signal transduction. Predicted to be active in cytoplasm. Is expressed in nervous system and trigeminal placode. Orthologous to human PPP1R1C (protein phosphatase 1 regulatory inhibitor subunit 1C).

Ensembl:

ensembl_id ENSDART00000150119

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073565 lncRNA upstream 551180 43800876 ~ 43879792 (+) True XLOC_037388
TCONS_00073563 lncRNA upstream 629508 43798143 ~ 43801464 (+) False XLOC_037388
TCONS_00075186 lncRNA upstream 1525350 42732199 ~ 42905622 (+) False XLOC_037385
TCONS_00075188 lncRNA upstream 1525350 42732992 ~ 42905622 (+) False XLOC_037385
TCONS_00075187 lncRNA upstream 1529435 42732991 ~ 42901537 (+) False XLOC_037385
TCONS_00073584 lncRNA downstream 526218 44995647 ~ 44998575 (+) False XLOC_037398
TCONS_00075191 lncRNA downstream 570336 45039765 ~ 45044991 (+) True XLOC_037399
TCONS_00075192 lncRNA downstream 643067 45112496 ~ 45116841 (+) False XLOC_037401
TCONS_00074933 lncRNA downstream 791955 45261384 ~ 45261761 (+) True XLOC_037403
TCONS_00074934 lncRNA downstream 1079358 45548787 ~ 45553378 (+) False XLOC_037404
TCONS_00073571 mRNA upstream 10592 44391254 ~ 44420380 (+) False XLOC_037392
TCONS_00073572 mRNA upstream 26812 44397151 ~ 44404160 (+) True XLOC_037392
TCONS_00073570 mRNA upstream 61115 44304980 ~ 44369857 (+) True XLOC_037391
TCONS_00073567 mRNA upstream 342905 44034790 ~ 44088067 (+) False XLOC_037390
TCONS_00073568 mRNA upstream 342905 44034797 ~ 44088067 (+) False XLOC_037390
TCONS_00073577 mRNA downstream 252379 44721808 ~ 44824500 (+) False XLOC_037395
TCONS_00073578 mRNA downstream 252776 44722205 ~ 44825419 (+) False XLOC_037395
TCONS_00073579 mRNA downstream 252807 44722236 ~ 44757162 (+) False XLOC_037395
TCONS_00073580 mRNA downstream 252838 44722267 ~ 44825345 (+) True XLOC_037395
TCONS_00073581 mRNA downstream 362603 44832032 ~ 44839148 (+) True XLOC_037396
TCONS_00073566 other upstream 575362 43855495 ~ 43855610 (+) True XLOC_037389
TCONS_00073561 other upstream 655607 43775251 ~ 43775365 (+) True XLOC_037387
TCONS_00073560 other upstream 1099461 43331395 ~ 43331511 (+) True XLOC_037386
TCONS_00073552 other upstream 2305588 42099737 ~ 42125384 (+) True XLOC_037378
TCONS_00073546 other upstream 2335795 42040557 ~ 42095177 (+) False XLOC_037378
TCONS_00073582 other downstream 462746 44932175 ~ 44932293 (+) True XLOC_037397
TCONS_00073585 other downstream 526840 44996269 ~ 44997423 (+) True XLOC_037398
TCONS_00073586 other downstream 594726 45064155 ~ 45064269 (+) True XLOC_037400
TCONS_00073589 other downstream 757672 45227101 ~ 45334105 (+) False XLOC_037402
TCONS_00073592 other downstream 1071048 45540477 ~ 45540593 (+) True XLOC_037402

Expression Profile

//