RNA id: TCONS_00073607


Basic Information

Item Value
RNA id TCONS_00073607
length 601
RNA type mRNA
GC content 0.48
exon number 2
gene id XLOC_037418
representative False

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 47961482 ~ 47970760 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAAACACAGAGAGAGTTCACATGTGAAAGGATACTCGTGGACTCGCTGATTCACGCATGGAGGGAAAAATCGCATGACAATCTGCTGGATGAAGATTGACTTTCATATGATGTTTTCAGGACTCACCCTTACAGCAGATGGAGACGGCTTAACCATCATGGATCCAGAGGACAAACTGAGCAGAGAAAAGCTGATCTTCTATCTCACAGTCCCACTTTCCTCCATCATCATCTTCACCAACCTCTTCATCATAATCGGCATTGCATGCAACCGGCAGCTCCACAACACTCCCAATTACTTCTTCTTGAGTCTCCTGGTGGCCGATTTATGCACGGGCATCACGCTTCCCTTCATTCCCCGCATGAGCCTGGACCGACAGCTGGATTTCAGACACTGCCTGGTCATGTACATCTTTCCCAACTTTCTGTTCCTGTCATTCCTGTTCAATTTGGTGATGGTGCATTACGAGCGCTACCTCTGCATCGTCAGCCCGCTCCATCACAGTCAGTTCTGGGTTCATCGATGTTTCCCGTTGGCGCTATTGACGGTTTGGCTTCCTCCATTGCTTTACGCATCACTTCCTGCTTTTGGATGGAACAAC

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG:

id description
ko04030 G protein-coupled receptors

ZFIN:

id description
ZDB-GENE-120315-1 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human GPBAR1 (G protein-coupled bile acid receptor 1).

Ensembl:

ensembl_id ENSDART00000168395

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00075203 lncRNA upstream 638759 47148499 ~ 47322964 (+) False XLOC_037417
TCONS_00075200 lncRNA upstream 645516 46854545 ~ 47316207 (+) False XLOC_037417
TCONS_00073616 lncRNA downstream 155652 48123162 ~ 48127695 (+) False XLOC_037422
TCONS_00075205 lncRNA downstream 155652 48123162 ~ 48129327 (+) False XLOC_037422
TCONS_00073618 lncRNA downstream 160098 48127608 ~ 48129327 (+) True XLOC_037422
TCONS_00074937 lncRNA downstream 413345 48380855 ~ 48381572 (+) True XLOC_037425
TCONS_00073625 lncRNA downstream 715265 48682775 ~ 48687885 (+) True XLOC_037427
TCONS_00073605 mRNA upstream 1162103 46745348 ~ 46799620 (+) True XLOC_037415
TCONS_00073604 mRNA upstream 1277184 46644633 ~ 46684539 (+) True XLOC_037414
TCONS_00073601 mRNA upstream 2118244 45839260 ~ 45843479 (+) True XLOC_037409
TCONS_00073599 mRNA upstream 2167529 45789887 ~ 45794194 (+) True XLOC_037407
TCONS_00073598 mRNA upstream 2264079 45680802 ~ 45697644 (+) True XLOC_037406
TCONS_00073610 mRNA downstream 39571 48007081 ~ 48039964 (+) False XLOC_037419
TCONS_00073609 mRNA downstream 39571 48007081 ~ 48039964 (+) True XLOC_037419
TCONS_00073611 mRNA downstream 117529 48085039 ~ 48091741 (+) False XLOC_037420
TCONS_00073612 mRNA downstream 120521 48088031 ~ 48089122 (+) True XLOC_037420
TCONS_00073613 mRNA downstream 140664 48108174 ~ 48109197 (+) True XLOC_037421
TCONS_00073602 other upstream 1530590 46421027 ~ 46431133 (+) False XLOC_037412
TCONS_00073600 other upstream 2140138 45821469 ~ 45821585 (+) True XLOC_037408
TCONS_00073592 other upstream 2421130 45540477 ~ 45540593 (+) True XLOC_037402
TCONS_00073589 other upstream 2627618 45227101 ~ 45334105 (+) False XLOC_037402
TCONS_00073586 other upstream 2897454 45064155 ~ 45064269 (+) True XLOC_037400
TCONS_00073638 other downstream 1817810 49785320 ~ 49785437 (+) True XLOC_037435
TCONS_00073648 other downstream 2121490 50089000 ~ 50090257 (+) True XLOC_037440
TCONS_00073655 other downstream 2832847 50800357 ~ 50800473 (+) True XLOC_037446
TCONS_00073665 other downstream 4114801 52082311 ~ 52082437 (+) True XLOC_037460
TCONS_00073706 other downstream 7280690 55248200 ~ 55248314 (+) True XLOC_037493

Expression Profile

//