RNA id: TU57818



Basic Information


Item Value
RNA id TU57818
length 475
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G43037
representative True

Chromosome Information


Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 32353086 ~ 32353560 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


agaagatttgcactttttcacaaattgagatgtttaccgtgtctgtgcggtgcgtgacttgtgccagggctagcatcgctaatcatagcttacatcaactttcactagcagtgattttaaatggatttctccaaatagcatgccaaactttacctttcgagtagaaacttcgcgactgaggcatcagtggagagcccaacctgtgcttttagcgcacgccagcgtgtgaaacattctcccaaaaacactccggtcttgtttctttcttcagaggcctttctcttcttgtcatacctttcgtagacactcgtagctcaccacacatatacacctgaaagtattcatgcgcagaaagcgaaaactaccctagggacgagcacgtacgacggccttacgtaaacatagcgccagaatgattgacaactaggaggaccaatagtcttgatgatccacccggaaaaagaaaatcctccac

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
XR_005639070.1 lncRNA upstream 565214 31781477 ~ 31787872 (+) True LOC120558237
TU57753 lncRNA upstream 591655 31698778 ~ 31761431 (+) True G42989
TU57750 lncRNA upstream 716149 31635978 ~ 31636937 (+) True G42986
XR_005638884.1 lncRNA upstream 783477 31565448 ~ 31569609 (+) False LOC120556663
TU57747 lncRNA upstream 783487 31568266 ~ 31569599 (+) True LOC120556663
TU57833 lncRNA downstream 106104 32459664 ~ 32459875 (+) True G43044
TU57835 lncRNA downstream 108479 32462039 ~ 32462312 (+) True G43046
TU57836 lncRNA downstream 111199 32464759 ~ 32466215 (+) True G43047
TU57840 lncRNA downstream 113946 32467506 ~ 32467810 (+) True G43048
TU57841 lncRNA downstream 115287 32468847 ~ 32469083 (+) True G43049
XM_039797122.1 mRNA upstream 935594 31377980 ~ 31417492 (+) True zgc:171566
XM_039798972.1 mRNA upstream 1479580 30821681 ~ 30873506 (+) True LOC120558103
XM_039798881.1 mRNA upstream 1667551 30679316 ~ 30685535 (+) True lsm3
XM_039799187.1 mRNA upstream 1839598 30504694 ~ 30513488 (+) True abraa
XM_039796714.1 mRNA upstream 1910087 30429564 ~ 30442999 (+) False tomm34
XM_039796522.1 mRNA downstream 27122 32380682 ~ 32444324 (+) True rspo4
XM_039797652.1 mRNA downstream 294039 32647599 ~ 32730753 (+) True ripor3
XM_039797650.1 mRNA downstream 294039 32647599 ~ 32730753 (+) False ripor3
XM_039797654.1 mRNA downstream 294039 32647599 ~ 32730753 (+) False ripor3
XM_039797651.1 mRNA downstream 313951 32667511 ~ 32730753 (+) False ripor3
TU57106 other upstream 3110833 29240413 ~ 29242253 (+) True G42449
XR_005639013.1 other upstream 5654515 26653260 ~ 26698571 (+) False anks1ab
TU56292 other upstream 5804287 26542507 ~ 26548799 (+) False G41850
TU56293 other upstream 5804287 26542507 ~ 26548799 (+) False G41850
TU56251 other upstream 6079771 26268602 ~ 26273315 (+) True G41825
TU57834 other downstream 106572 32460132 ~ 32460863 (+) True G43045
TU57843 other downstream 117235 32470795 ~ 32471605 (+) True G43051
TU58042 other downstream 684374 33037934 ~ 33041264 (+) False LOC120556790
TU58122 other downstream 834178 33187738 ~ 33212318 (+) True G43277
XR_005639022.1 other downstream 908635 33262195 ~ 33336767 (+) True angpt4

Expression Profile


TU57818 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU57818 Expression in each Bioproject

Bar chart with 8 bars.
TU57818 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.