RNA id: TU60992


Basic Information

Item Value
RNA id TU60992
length 469
RNA type TUCP
GC content 0.41
exon number 1
gene id G45557
representative True

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 43838384 ~ 43838852 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence

ctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctgtacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggagatatgctggctctatacacactaaaagtcctgattatttacatggagtctggtggaaatatgctggctctatacacgctaaaagtcctgattatttacatggagtctggtggaaatatgctggctctataca

Function

GO: NA

KEGG:

id description
ko01040 Biosynthesis of unsaturated fatty acids
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU60984 lncRNA upstream 69312 43768871 ~ 43769072 (+) True G45550
TU60973 lncRNA upstream 136376 43622307 ~ 43702008 (+) True G45540
TU60976 lncRNA upstream 194484 43643674 ~ 43643900 (+) True G45543
TU60972 lncRNA upstream 222292 43615850 ~ 43616092 (+) True G45539
TU60971 lncRNA upstream 224786 43613398 ~ 43613598 (+) True G45538
TU60997 lncRNA downstream 52263 43891115 ~ 43939634 (+) False G45562
TU60999 lncRNA downstream 93792 43932644 ~ 43939634 (+) True G45562
TU61016 lncRNA downstream 114987 43953839 ~ 43954039 (+) True G45576
TU61019 lncRNA downstream 124745 43963597 ~ 43963822 (+) True G45579
TU61021 lncRNA downstream 148083 43986935 ~ 43987969 (+) True G45580
XM_039796385.1 mRNA upstream 259379 43568609 ~ 43579005 (+) True nicn1
XM_039796388.1 mRNA upstream 259379 43568609 ~ 43579005 (+) False nicn1
XM_039797177.1 mRNA upstream 395860 43412120 ~ 43442524 (+) True LOC120557146
XM_039798764.1 mRNA upstream 1179996 42654788 ~ 42658388 (+) True rbm15b
XM_039798345.1 mRNA upstream 1187053 42645340 ~ 42651331 (+) True manf
XM_039798846.1 mRNA downstream 56782 43895634 ~ 44107691 (+) True LOC120558025
XM_039798845.1 mRNA downstream 56782 43895634 ~ 44107691 (+) False LOC120558025
XM_039798847.1 mRNA downstream 56782 43895634 ~ 44107691 (+) False LOC120558025
XM_039797100.1 mRNA downstream 377561 44216413 ~ 44220156 (+) True amigo3
XM_039797327.1 mRNA downstream 511555 44350407 ~ 44352218 (+) True LOC120557212
XR_005639071.1 other upstream 327925 43510346 ~ 43510459 (+) True LOC120558241
TU60535 other upstream 1536489 42278285 ~ 42301895 (+) True G45237
TU60468 other upstream 1926298 41905529 ~ 41912086 (+) True map1lc3a
TU60467 other upstream 1926298 41905607 ~ 41912086 (+) False map1lc3a
TU60460 other upstream 1935766 41897022 ~ 41902618 (+) False dynlrb1
TU61017 other downstream 117975 43956827 ~ 43957173 (+) True G45577
TU61091 other downstream 521934 44360786 ~ 44361368 (+) False G45635
TU61117 other downstream 565051 44403903 ~ 44407449 (+) True G45647
TU61239 other downstream 650147 44488999 ~ 44494719 (+) False tsen2
TU61241 other downstream 656724 44495576 ~ 44499296 (+) False tsen2

Expression Profile