RNA id: TCONS_00073890


Basic Information

Item Value
RNA id TCONS_00073890
length 97
RNA type mRNA
GC content 0.48
exon number 2
gene id XLOC_037629
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 7394229 ~ 7394412 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTTCACTCTGGTATATCTACACTGCTGCAGAGCTGGATTGGATCACGTTTGCCATTGATTCAGGCTCCATCTTTGGACTTTCTGATCCCGGCCATG

Function

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022857 transmembrane transporter activity molecular_function
GO:0005215 transporter activity molecular_function

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-070912-714 Predicted to enable transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human SLC23A3 (solute carrier family 23 member 3).

Ensembl:

ensembl_id ENSDART00000145456

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073887 lncRNA downstream 34745 7357819 ~ 7359484 (-) True XLOC_037626
TCONS_00074961 lncRNA downstream 845433 6531549 ~ 6548796 (-) True XLOC_037614
TCONS_00073869 lncRNA downstream 892136 6414784 ~ 6502093 (-) True XLOC_037612
TCONS_00075290 lncRNA downstream 2348240 5044975 ~ 5045989 (-) True XLOC_037603
TCONS_00073852 lncRNA downstream 2350141 5043087 ~ 5044088 (-) False XLOC_037603
TCONS_00075291 lncRNA upstream 104848 7499260 ~ 7505531 (-) True XLOC_037631
TCONS_00075292 lncRNA upstream 547357 7941769 ~ 7942597 (-) True XLOC_037636
TCONS_00075293 lncRNA upstream 765929 8160341 ~ 8163995 (-) True XLOC_037637
TCONS_00075294 lncRNA upstream 889743 8284155 ~ 8286208 (-) True XLOC_037638
TCONS_00073916 lncRNA upstream 1614711 9009123 ~ 9024269 (-) False XLOC_037644
TCONS_00073889 mRNA downstream 3841 7390207 ~ 7390388 (-) True XLOC_037628
TCONS_00073888 mRNA downstream 15663 7371962 ~ 7378566 (-) True XLOC_037627
TCONS_00073884 mRNA downstream 106854 7275185 ~ 7287375 (-) False XLOC_037625
TCONS_00073886 mRNA downstream 107101 7275186 ~ 7287128 (-) False XLOC_037625
TCONS_00073885 mRNA downstream 107101 7275186 ~ 7287128 (-) True XLOC_037625
TCONS_00073891 mRNA upstream 16386 7410798 ~ 7421135 (-) False XLOC_037630
TCONS_00073893 mRNA upstream 16386 7410798 ~ 7444590 (-) False XLOC_037630
TCONS_00073892 mRNA upstream 16386 7410798 ~ 7444590 (-) False XLOC_037630
TCONS_00073894 mRNA upstream 29504 7423916 ~ 7444753 (-) True XLOC_037630
TCONS_00073895 mRNA upstream 121452 7515864 ~ 7539297 (-) False XLOC_037632
TCONS_00073875 other downstream 676428 6717677 ~ 6717801 (-) True XLOC_037618
TCONS_00073868 other downstream 984958 6409157 ~ 6409271 (-) True XLOC_037613
TCONS_00073841 other downstream 2947125 4443918 ~ 4447104 (-) True XLOC_037598
TCONS_00073830 other downstream 3874518 3508318 ~ 3519711 (-) True XLOC_037592
TCONS_00073827 other downstream 3897650 3490831 ~ 3496579 (-) True XLOC_037591
TCONS_00073897 other upstream 128023 7522435 ~ 7539023 (-) True XLOC_037632
TCONS_00073901 other upstream 247348 7641760 ~ 7655301 (-) True XLOC_037633
TCONS_00073935 other upstream 2349147 9743559 ~ 9805319 (-) False XLOC_037657
TCONS_00073936 other upstream 2375923 9770335 ~ 9805319 (-) True XLOC_037657
TCONS_00073961 other upstream 3451506 10845918 ~ 10846549 (-) True XLOC_037667

Expression Profile

//