RNA id: TU83270



Basic Information


Item Value
RNA id TU83270
length 229
lncRNA type inter_gene
GC content 0.36
exon number 1
gene id G62186
representative True

Chromosome Information


Item Value
chromosome id NC_053117.1
NCBI id CM020914.1
chromosome length 43979800
location 17091256 ~ 17091484 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome
species eurasian perch
(Perca fluviatilis)

Sequence


tcgactttattgtcattgcgcagagtacaagtacaaagacagcgaaatgcagtttgcgtccaaccagaagtgcaaaaataaaaagcagaaaagtgcaatgcgatatacaagtatagacaggtagtgcataggcaggacaagaaatatattgttgtaagagcagaataaatatggctatgtaatatgaacaatgtatgaacaacatgtacagatatgtgcaatgtagtag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU83267 lncRNA upstream 6740 17077903 ~ 17084516 (+) True G62184
TU83197 lncRNA upstream 137619 16952925 ~ 16953637 (+) True G62126
XR_005639513.1 lncRNA upstream 148080 16905593 ~ 16943176 (+) False LOC120560795
TU83185 lncRNA upstream 148527 16905605 ~ 16942729 (+) False LOC120560795
TU83182 lncRNA upstream 148527 16905813 ~ 16942729 (+) False LOC120560795
TU83272 lncRNA downstream 1885 17093369 ~ 17093740 (+) True G62188
TU83277 lncRNA downstream 32122 17123606 ~ 17124484 (+) True G62193
TU83280 lncRNA downstream 107905 17199389 ~ 17199599 (+) True G62196
TU83282 lncRNA downstream 321592 17413076 ~ 17414591 (+) False LOC120560947
TU83288 lncRNA downstream 323168 17414652 ~ 17415349 (+) True G62204
XM_039802922.1 mRNA upstream 66288 17018577 ~ 17024968 (+) True ccnh
XM_039803345.1 mRNA upstream 112861 16959457 ~ 16978395 (+) True tmem161b
XM_039802673.1 mRNA upstream 196068 16835490 ~ 16895188 (+) False mef2cb
XM_039803855.1 mRNA downstream 194164 17285648 ~ 17414595 (+) True LOC120560947
XM_039803856.1 mRNA downstream 194166 17285650 ~ 17414595 (+) False LOC120560947
XM_039804546.1 mRNA downstream 380779 17472263 ~ 17480557 (+) True LOC120561427
XM_039803291.1 mRNA downstream 476529 17568013 ~ 17572705 (+) True tmem167a
XM_039803150.1 mRNA downstream 500461 17591945 ~ 17593975 (+) True LOC120560529
TU83072 other upstream 557107 16533329 ~ 16534149 (+) False LOC120560897
TU83070 other upstream 615351 16468367 ~ 16475905 (+) False LOC120560890
XR_005639530.1 other upstream 615359 16468323 ~ 16475897 (+) False LOC120560890
TU82943 other upstream 1314115 15763114 ~ 15777141 (+) True mctp1a
unassigned_transcript_261 other upstream 1472112 15619073 ~ 15619144 (+) True trnac-gca_21
XR_005639579.1 other downstream 907202 17998686 ~ 18009318 (+) False cmya5
TU83701 other downstream 1239221 18330705 ~ 18331230 (+) True G62513
TU83742 other downstream 1315903 18407387 ~ 18416006 (+) False tbx5b
TU83744 other downstream 1324644 18416128 ~ 18419590 (+) False tbx5b
XR_005639481.1 other downstream 1569673 18661157 ~ 18681161 (+) False acacb

Expression Profile


TU83270 Expression in all Baseline Samples

Bar chart with 13 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU83270 Expression in each Bioproject

Bar chart with 8 bars.
TU83270 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.