RNA id: TCONS_00074453


Basic Information

Item Value
RNA id TCONS_00074453
length 579
RNA type mRNA
GC content 0.45
exon number 2
gene id XLOC_037926
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 31494941 ~ 31525126 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCGCTCTAGCAGGAAGTTGACGCGAGCGAGGCTCATACAGGGATCAGCCATCGTTCAGCCACGTATTAAGCTTTTAATTTTACATTCAGTGATCTTTGCATCGTATATGTGACACCGATGATTTAAAGCCTGTACTGCTCGTCTCTTACAGATTGCAAATCGTCCTCGTCGGCGGGCAGACAGTCATTGACGTCAGTGCACGTTTATACTATTAATATTTGTAAATCATGTTTTGACTGTAGTCATTCGCGCACGAGCAAAATATACGAGTAGGATATATGAAACAGAGAATGTTGAATGTGTGAATGGTTTCGTATCCTTTGCTCGACCTGAAAGCCGGTTGCTATGCACTGTGTGCATCTGTGTCTACAACCATGCAGTATTGCGTGCAACTGTGCTGAAATGTCACACAGTCTTTTCTAACACACCTCTGTGGTGCATACAGTAGTGGTGGGTCAGAATGAAAAGAAACCACATGAAAAATGGTGCTTTCTGAGCCTTACTGGGATCATCACATCCCCCTGCCAAAACTGGGACCCTTGCACTCCCGGCTGACTACTGCCTTTGTTGCCCTGATCT

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-148 Predicted to enable dolichyl-phosphate-mannose-protein mannosyltransferase activity. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Is expressed in central nervous system; neural plate; and retinal ganglion cell layer. Orthologous to human TMTC4 (transmembrane O-mannosyltransferase targeting cadherins 4).

Ensembl:

ensembl_id ENSDART00000146268

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00074443 lncRNA downstream 252456 31264412 ~ 31271926 (-) False XLOC_037924
TCONS_00075386 lncRNA downstream 252774 31264412 ~ 31271608 (-) False XLOC_037924
TCONS_00074444 lncRNA downstream 252932 31266259 ~ 31271450 (-) True XLOC_037924
TCONS_00075385 lncRNA downstream 633941 30879720 ~ 30890441 (-) True XLOC_037918
TCONS_00075384 lncRNA downstream 633986 30879720 ~ 30890396 (-) False XLOC_037918
TCONS_00074459 lncRNA upstream 230006 31755081 ~ 31780466 (-) True XLOC_037928
TCONS_00074460 lncRNA upstream 233558 31758633 ~ 31763256 (-) False XLOC_037929
TCONS_00075387 lncRNA upstream 272770 31797845 ~ 31810047 (-) True XLOC_037930
TCONS_00074988 lncRNA upstream 532631 32057706 ~ 32058334 (-) True XLOC_037932
TCONS_00074464 lncRNA upstream 571256 32096331 ~ 32105779 (-) False XLOC_037933
TCONS_00074445 mRNA downstream 246334 31274108 ~ 31278048 (-) False XLOC_037925
TCONS_00074441 mRNA downstream 388374 31134907 ~ 31136008 (-) True XLOC_037922
TCONS_00074440 mRNA downstream 416097 31105389 ~ 31108285 (-) True XLOC_037921
TCONS_00074439 mRNA downstream 433789 31089649 ~ 31090593 (-) True XLOC_037920
TCONS_00074438 mRNA downstream 716309 30800876 ~ 30808073 (-) True XLOC_037917
TCONS_00074454 mRNA upstream 64350 31589425 ~ 31741731 (-) False XLOC_037927
TCONS_00074455 mRNA upstream 64350 31589425 ~ 31747106 (-) False XLOC_037927
TCONS_00074456 mRNA upstream 67155 31592230 ~ 31596016 (-) False XLOC_037927
TCONS_00074457 mRNA upstream 171056 31696131 ~ 31747106 (-) False XLOC_037927
TCONS_00074458 mRNA upstream 171057 31696132 ~ 31747106 (-) True XLOC_037927
TCONS_00074446 other downstream 210058 31274108 ~ 31314324 (-) True XLOC_037925
TCONS_00074442 other downstream 336523 31187738 ~ 31187859 (-) True XLOC_037923
TCONS_00074437 other downstream 816428 30707839 ~ 30707954 (-) True XLOC_037916
TCONS_00074436 other downstream 844364 30677470 ~ 30680018 (-) True XLOC_037915
TCONS_00074423 other downstream 1227591 30296675 ~ 30296791 (-) True XLOC_037905
TCONS_00074461 other upstream 234431 31759506 ~ 31761529 (-) False XLOC_037929
TCONS_00074471 other upstream 675575 32200650 ~ 32205543 (-) False XLOC_037937
TCONS_00074475 other upstream 734739 32259814 ~ 32264658 (-) False XLOC_037940
TCONS_00074476 other upstream 749233 32274308 ~ 32279187 (-) True XLOC_037942
TCONS_00074481 other upstream 830160 32355235 ~ 32358665 (-) True XLOC_037945

Expression Profile

//