RNA id: XR_003404038.2



Basic Information


Item Value
RNA id XR_003404038.2
length 360
lncRNA type inter_gene
GC content 0.48
exon number 2
gene id LOC113540553
representative False

Chromosome Information


Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 24839221 ~ 24849487 (+)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome
species striped catfish
(Pangasianodon hypophthalmus)

Sequence


TTTGTGTGCATGCGTCTCAGTTCCTGAGTCGTTCTAGAGGAGGAGCGTGATGCAGAGTAGCGCTCAGGGCCCGGCCTGCGCTCACAGTGGAGTAAAAAAGCATAAGGCTCCATGCCTTAAGGCTCCTCTGGCTGGATATGGAACTTCTCAGGACAGCCGGGACCAAACTGAAGCTCCTCCAGAGCCTCAGAGAACGCTGTTATCTGTTCCATCTTGTTAGAGAACATCTGGAGAAAATATCTGGAGAGCTACTTATTGGGAGTGGACTTTGAAGAACAGAGATGTTATGTGTCATTTGGGAAAGTAAGGCTGTTGCAATGTTTTTGTGTACTGTGCAATATTAAAACCCTTTGGTCCAGA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU83289 lncRNA upstream 89308 24681981 ~ 24749913 (+) True G70204
TU83226 lncRNA upstream 253314 24585427 ~ 24585907 (+) True G70142
TU83224 lncRNA upstream 254382 24584614 ~ 24584839 (+) True G70140
TU83223 lncRNA upstream 255845 24583176 ~ 24583376 (+) True G70139
TU83222 lncRNA upstream 264651 24574336 ~ 24574570 (+) True G70138
TU83637 lncRNA downstream 151195 24997916 ~ 24998225 (+) True G70520
XR_004578007.1 lncRNA downstream 481497 25328218 ~ 25330540 (+) True LOC117597084
TU83828 lncRNA downstream 710116 25556837 ~ 25557761 (+) True G70695
TU83897 lncRNA downstream 711706 25558427 ~ 25561346 (+) True G70763
TU83912 lncRNA downstream 738605 25585326 ~ 25585534 (+) True G70778
XM_026936109.2 mRNA upstream 31817 24792295 ~ 24807404 (+) True kiss1ra
XM_026936117.2 mRNA upstream 242112 24587207 ~ 24597109 (+) True zgc:113531
XM_026936540.2 mRNA upstream 277943 24507205 ~ 24561278 (+) True slc6a9
XM_026935923.2 mRNA downstream 12305 24859026 ~ 24871164 (+) True kif2c
XM_026935924.2 mRNA downstream 12306 24859027 ~ 24871164 (+) False kif2c
XM_026937276.2 mRNA downstream 148156 24994877 ~ 25013306 (+) True klhl20
XM_026937138.2 mRNA downstream 174892 25021613 ~ 25047317 (+) True dars2
XM_026936668.2 mRNA downstream 423501 25270222 ~ 25552839 (+) True astn1
TU83028 other upstream 729332 24108795 ~ 24109889 (+) True G69971
TU82445 other upstream 1518878 23318504 ~ 23320343 (+) True G69509
XR_003404030.2 other upstream 3076920 21754080 ~ 21762301 (+) True LOC113540377
XR_003403979.2 other downstream 12305 24859026 ~ 24871263 (+) False kif2c
XR_003404013.2 other downstream 861106 25707827 ~ 25881109 (+) False tnr
TU84209 other downstream 1051414 25898135 ~ 25901843 (+) False LOC113539772
TU84572 other downstream 1382043 26228764 ~ 26229191 (+) True G71385
XR_003404061.2 other downstream 1441569 26288290 ~ 26292784 (+) True zgc:66427

Expression Profile


XR_003404038.2 Expression in all Baseline Samples

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

XR_003404038.2 Expression in each Bioproject

Bar chart with 3 bars.
XR_003404038.2 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.