RNA id: TCONS_00000061


Basic Information

Item Value
RNA id TCONS_00000061
length 81
RNA type miRNA
GC content 0.44
exon number 1
gene id XLOC_000032
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 1571847 ~ 1578251 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTCTTGCTCTCAGTAACAAGGATTCATCCTGTTGTGGTACTCAAATCCAACAGGGAATCTCTGTTACTGGGGTTAAGGTT

Function

GO:

id name namespace
GO:0042737 drug catabolic process biological_process
GO:0042738 exogenous drug catabolic process biological_process
GO:0019265 glycine biosynthetic process, by transamination of glyoxylate biological_process
GO:0006082 organic acid metabolic process biological_process
GO:0009074 aromatic amino acid family catabolic process biological_process
GO:0042493 response to drug biological_process
GO:0017144 drug metabolic process biological_process
GO:0046395 carboxylic acid catabolic process biological_process
GO:0009410 response to xenobiotic stimulus biological_process
GO:0043436 oxoacid metabolic process biological_process
GO:0044281 small molecule metabolic process biological_process
GO:0044282 small molecule catabolic process biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0071466 cellular response to xenobiotic stimulus biological_process
GO:0006805 xenobiotic metabolic process biological_process
GO:0006570 tyrosine metabolic process biological_process
GO:0006572 tyrosine catabolic process biological_process
GO:0019752 carboxylic acid metabolic process biological_process
GO:0016054 organic acid catabolic process biological_process
GO:0008395 steroid hydroxylase activity molecular_function
GO:0004760 serine-pyruvate transaminase activity molecular_function
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen molecular_function
GO:0004180 carboxypeptidase activity molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0005506 iron ion binding molecular_function
GO:0008453 alanine-glyoxylate transaminase activity molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0046906 tetrapyrrole binding molecular_function
GO:0046914 transition metal ion binding molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008235 metalloexopeptidase activity molecular_function
GO:0008238 exopeptidase activity molecular_function
GO:0008241 peptidyl-dipeptidase activity molecular_function
GO:0020037 heme binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000118322

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003011 lncRNA upstream 214652 1358897 ~ 1360831 (+) True XLOC_000031
TCONS_00003010 lncRNA upstream 215032 1358731 ~ 1360451 (+) False XLOC_000031
TCONS_00003009 lncRNA upstream 233246 1315289 ~ 1342237 (+) True XLOC_000030
TCONS_00003008 lncRNA upstream 253530 1315289 ~ 1321953 (+) False XLOC_000030
TCONS_00003007 lncRNA upstream 541845 1015812 ~ 1033638 (+) False XLOC_000028
TCONS_00003014 lncRNA downstream 41640 1617203 ~ 1619314 (+) False XLOC_000034
TCONS_00003013 lncRNA downstream 41640 1617203 ~ 1619314 (+) False XLOC_000034
TCONS_00003012 lncRNA downstream 41640 1617203 ~ 1619314 (+) True XLOC_000034
TCONS_00000064 lncRNA downstream 114484 1690047 ~ 1691025 (+) False XLOC_000035
TCONS_00000065 lncRNA downstream 129567 1705130 ~ 1705880 (+) True XLOC_000035
TCONS_00000059 mRNA upstream 604532 961607 ~ 970951 (+) True XLOC_000027
TCONS_00000058 mRNA upstream 967236 604127 ~ 608247 (+) True XLOC_000025
TCONS_00000057 mRNA upstream 967428 594736 ~ 608055 (+) False XLOC_000025
TCONS_00000056 mRNA upstream 972086 594584 ~ 603397 (+) False XLOC_000025
TCONS_00000054 mRNA upstream 984152 580642 ~ 591331 (+) False XLOC_000023
TCONS_00000062 mRNA downstream 24416 1599979 ~ 1614500 (+) True XLOC_000033
TCONS_00000063 mRNA downstream 114212 1689775 ~ 1706159 (+) False XLOC_000035
TCONS_00000066 mRNA downstream 136577 1712140 ~ 1731564 (+) False XLOC_000036
TCONS_00000072 mRNA downstream 213794 1789357 ~ 1796832 (+) False XLOC_000036
TCONS_00000074 mRNA downstream 229731 1805294 ~ 1815660 (+) True XLOC_000037
TCONS_00000060 other upstream 356678 1218691 ~ 1218805 (+) True XLOC_000029
TCONS_00000053 other upstream 998962 576444 ~ 576521 (+) True XLOC_000024
TCONS_00000052 other upstream 1029266 537589 ~ 546217 (+) False XLOC_000023
TCONS_00000047 other upstream 1060161 514013 ~ 515322 (+) True XLOC_000021
TCONS_00000036 other upstream 1281589 260040 ~ 293894 (+) False XLOC_000017
TCONS_00000067 other downstream 136590 1712153 ~ 1718527 (+) False XLOC_000036
TCONS_00000068 other downstream 142134 1717697 ~ 1723157 (+) False XLOC_000036
TCONS_00000069 other downstream 143048 1718611 ~ 1793371 (+) False XLOC_000036
TCONS_00000070 other downstream 143644 1719207 ~ 1732326 (+) False XLOC_000036
TCONS_00000094 other downstream 615137 2190700 ~ 2214397 (+) False XLOC_000046