RNA id: TCONS_00007964


Basic Information

Item Value
RNA id TCONS_00007964
length 89
RNA type miRNA
GC content 0.45
exon number 1
gene id XLOC_004167
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 27502205 ~ 27507973 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACGGTGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACACTGGGAGATAACTATACAACCTACTGTCTTTCTCAAAGTC

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0000027 ribosomal large subunit assembly biological_process
GO:0000028 ribosomal small subunit assembly biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0043604 amide biosynthetic process biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0006412 translation biological_process
GO:0006414 translational elongation biological_process
GO:0006457 protein folding biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042255 ribosome assembly biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0044391 ribosomal subunit cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0022625 cytosolic large ribosomal subunit cellular_component
GO:0022626 cytosolic ribosome cellular_component
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0044445 obsolete cytosolic part cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0005829 cytosol cellular_component
GO:0005832 chaperonin-containing T-complex cellular_component
GO:0005840 ribosome cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0005854 nascent polypeptide-associated complex cellular_component
GO:0101031 chaperone complex cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0043226 organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008135 translation factor activity, RNA binding molecular_function
GO:0019843 rRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function
GO:0051082 unfolded protein binding molecular_function

KEGG:

id description
ko00230 Purine metabolism
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000118379

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00007962 lncRNA downstream 100 27502509 ~ 27503132 (-) False XLOC_004167
TCONS_00008799 lncRNA downstream 836737 26619434 ~ 26666495 (-) False XLOC_004162
TCONS_00008798 lncRNA downstream 2026252 25475305 ~ 25476980 (-) False XLOC_004150
TCONS_00007926 lncRNA downstream 2026252 25475305 ~ 25476980 (-) False XLOC_004150
TCONS_00008797 lncRNA downstream 2026650 25475305 ~ 25476582 (-) False XLOC_004150
TCONS_00008800 lncRNA upstream 40258 27543578 ~ 27625465 (-) False XLOC_004169
TCONS_00007969 lncRNA upstream 89323 27592643 ~ 27625125 (-) False XLOC_004169
TCONS_00008801 lncRNA upstream 89323 27592643 ~ 27625455 (-) True XLOC_004169
TCONS_00008473 lncRNA upstream 202650 27705970 ~ 27706600 (-) False XLOC_004171
TCONS_00007976 lncRNA upstream 280438 27783758 ~ 27806767 (-) True XLOC_004173
TCONS_00007961 mRNA downstream 2205 27486584 ~ 27501027 (-) True XLOC_004166
TCONS_00007958 mRNA downstream 445660 26704181 ~ 27057572 (-) False XLOC_004164
TCONS_00007959 mRNA downstream 670547 26707262 ~ 26832685 (-) True XLOC_004164
TCONS_00007957 mRNA downstream 801621 26685982 ~ 26701611 (-) True XLOC_004163
TCONS_00007956 mRNA downstream 836731 26662624 ~ 26666501 (-) True XLOC_004162
TCONS_00007966 mRNA upstream 7957 27511277 ~ 27537661 (-) False XLOC_004168
TCONS_00007967 mRNA upstream 17001 27520321 ~ 27537650 (-) False XLOC_004168
TCONS_00007968 mRNA upstream 18193 27521513 ~ 27537593 (-) True XLOC_004168
TCONS_00007970 mRNA upstream 141204 27644524 ~ 27702778 (-) False XLOC_004170
TCONS_00007971 mRNA upstream 143355 27646675 ~ 27702835 (-) True XLOC_004170
TCONS_00007963 other downstream 100 27503017 ~ 27503132 (-) False XLOC_004167
TCONS_00007960 other downstream 754803 26748292 ~ 26748429 (-) True XLOC_004165
TCONS_00007954 other downstream 926023 26569531 ~ 26577209 (-) True XLOC_004161
TCONS_00007950 other downstream 1127714 26373998 ~ 26375518 (-) True XLOC_004160
TCONS_00007948 other downstream 1265279 26233727 ~ 26237953 (-) True XLOC_004159
TCONS_00007974 other upstream 210144 27713464 ~ 27719269 (-) True XLOC_004171
TCONS_00007992 other upstream 574828 28078148 ~ 28086924 (-) False XLOC_004178
TCONS_00008006 other upstream 1087568 28590888 ~ 28595428 (-) True XLOC_004184
TCONS_00008022 other upstream 2149370 29652690 ~ 29657852 (-) False XLOC_004191
TCONS_00008030 other upstream 2306377 29809697 ~ 29816202 (-) False XLOC_004195