RNA id: TCONS_00008100


Basic Information

Item Value
RNA id TCONS_00008100
length 693
lncRNA type retained_intron
GC content 0.45
exon number 4
gene id XLOC_004242
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 34219991 ~ 34232906 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTCGGCAACACCTGGACACACAAAGCACTTTCAGACTCTGTTTGTTGAACCCGGTCTTTGCCTGTGTGATTGTCCTGGACTGGTCATGCCTTCATTTGTGTCCACCAAAGCTGAGATGATCTGCAGCGGGATCCTACCCATCGATCAGATGAGAGATCACGTGCCAGCCATCTCTTTGATAACCTTTTACGCTGCATTGATTGTGACAGTTGCATTTTTAAACTTGATCGCAACACATACACTACTGTAAAGCTGCATGATCCATTTTACTAACCCTAAACATTTTGATTGGTAGTACGTAAGAATTTTTGTTATCAATGAGTTACCAAAAATCTGAAAAGTTTGGATTTTGTCCTTAGCACAAATACGTATGTCAGAATATCCCTCGAAATGTGCTGGAGGGGACTTACGGAATCAACATCATCAGACCGAGGGAGGACGAGGACCCTGATCGGCCGCCTACCTATGAGGAGCTGCTTATGGCATACGGATGTCAGTTCACTTTGCACAATATATGAGAGGCTTTATGACAGCACACGGACAGCCAGACCAATCAAGATCTGCTCGATATGTTTTAAAAGACTATGTCAGTGGCAAACTCCTCTACTGCCATCCTCCACCTCACATCGATCCTGAAGACTTCCAGCCTCAGCACGCCAAGTTTGCCATGCGGATAACAGAAGCCGAACAGAT

Function

GO:

id name namespace
GO:0000054 ribosomal subunit export from nucleus biological_process
GO:0051168 nuclear export biological_process
GO:0015031 protein transport biological_process
GO:0005783 endoplasmic reticulum cellular_component
GO:0005829 cytosol cellular_component
GO:0015030 Cajal body cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG:

id description
ko03008 Ribosome biogenesis in eukaryotes
ko03009 Ribosome biogenesis

ZFIN:

id description
ZDB-GENE-030131-2184 Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in ribosomal subunit export from nucleus. Predicted to act upstream of or within protein transport. Predicted to be located in Cajal body and endoplasmic reticulum. Predicted to be active in cytosol. Is expressed in eye; immature eye; midbrain; neural plate; and segmental plate. Orthologous to human LSG1 (large 60S subunit nuclear export GTPase 1).

Ensembl:

ensembl_id ENSDART00000160307

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008482 lncRNA downstream 229746 33992033 ~ 33993147 (-) True XLOC_004235
TCONS_00008832 lncRNA downstream 533944 33676834 ~ 33688949 (-) True XLOC_004229
TCONS_00008831 lncRNA downstream 536982 33676834 ~ 33685911 (-) False XLOC_004229
TCONS_00008481 lncRNA downstream 821417 33344982 ~ 33401476 (-) False XLOC_004227
TCONS_00008480 lncRNA downstream 878436 33339539 ~ 33344457 (-) False XLOC_004227
TCONS_00008101 lncRNA upstream 23658 34249456 ~ 34255220 (-) True XLOC_004243
TCONS_00008833 lncRNA upstream 89727 34315525 ~ 34358689 (-) True XLOC_004244
TCONS_00008834 lncRNA upstream 325049 34550847 ~ 34577001 (-) False XLOC_004249
TCONS_00008835 lncRNA upstream 1212215 35438013 ~ 35441417 (-) True XLOC_004255
TCONS_00008836 lncRNA upstream 1352932 35578730 ~ 35741441 (-) False XLOC_004257
TCONS_00008097 mRNA downstream 3682 34201183 ~ 34219211 (-) True XLOC_004241
TCONS_00008095 mRNA downstream 34547 34154593 ~ 34188346 (-) False XLOC_004240
TCONS_00008096 mRNA downstream 55933 34158178 ~ 34166960 (-) True XLOC_004240
TCONS_00008094 mRNA downstream 71406 34151177 ~ 34151487 (-) True XLOC_004239
TCONS_00008093 mRNA downstream 98574 34118359 ~ 34124319 (-) True XLOC_004238
TCONS_00008103 mRNA upstream 175662 34401460 ~ 34480822 (-) False XLOC_004246
TCONS_00008104 mRNA upstream 176618 34402416 ~ 34478225 (-) True XLOC_004246
TCONS_00008106 mRNA upstream 263071 34488869 ~ 34522249 (-) False XLOC_004248
TCONS_00008107 mRNA upstream 263612 34489410 ~ 34518362 (-) False XLOC_004248
TCONS_00008108 mRNA upstream 263612 34489410 ~ 34521342 (-) True XLOC_004248
TCONS_00008088 other downstream 256621 33966158 ~ 33966272 (-) True XLOC_004234
TCONS_00008078 other downstream 851526 33371251 ~ 33371367 (-) True XLOC_004227
TCONS_00008075 other downstream 1485300 32731165 ~ 32737593 (-) True XLOC_004221
TCONS_00008067 other downstream 3050639 31170349 ~ 31172254 (-) True XLOC_004210
TCONS_00008056 other downstream 3714102 30424226 ~ 30508791 (-) True XLOC_004205
TCONS_00008102 other upstream 129746 34355544 ~ 34355662 (-) True XLOC_004245
TCONS_00008105 other upstream 240597 34466395 ~ 34466513 (-) True XLOC_004247
TCONS_00008119 other upstream 999224 35225022 ~ 35225139 (-) True XLOC_004254
TCONS_00008174 other upstream 3073573 37299371 ~ 37299485 (-) True XLOC_004279
TCONS_00008194 other upstream 3949273 38175071 ~ 38175150 (-) True XLOC_004294

Expression Profile

//