RNA id: TCONS_00008147


Basic Information

Item Value
RNA id TCONS_00008147
length 769
RNA type mRNA
GC content 0.48
exon number 6
gene id XLOC_004265
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 36254284 ~ 36279664 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AACAGATCATCATTCAACAGCCACAGACCGCAGTCACTGCAGGACAAAACCAGGGTCAACAGCAGATTACAGTACAAGGTCAGCAAGTGGCTCAAACCGCTGAAGGACAGACCATCGTATACCAGCCTGTAAATGCAGACGGGACCATCCTACAGCAGGGAATGATCACCATTCCTGCTGCATCTTTAGCAGGAGCTCAGTTAGTCTCAGCTGGATCCAACACAAACACCACCAACACCGGTCAGGGCACAGTTACAGTCACTCTCCCCATGGCTGGAAACATGGTCAATGCTGGAGGAATGGTCATGATGGTGCCAGGCGGTAGCAATTCAGTTCCCACCATGCAGCGCATTCCTCTTCCTGGAGCAGAGATGTTGGAGGAGGAACCTTTGTATGTTAATGCAAAACAGTATCACCGGATACTCAAGAGGAGACAAGCTCGCGCCAAACTGGAGGCTGAAGGCAAAATACCCAAAGAGAGAAGAAAATACCTGCATGAGTCTCGTCATCGTCATGCTATGGCCAGGAAGCGTGGAGACGGTGGACGCTTTTTCTCTCCGAAGGAAAAGGAAGAAATGGCCCTGCAGGCCATAAAGAAAGCTGAGCAGGATCAAGGTGAAGAAGACAGAGTCGGCCAGATGATTCAGGTGGCATAAACTACCCCTTTCTGTTGTACAGTCTGTCCTTTATACTCGTTTTAAACGCAGGAAATTTCAACACATGACTTTCCCTGCTTCTAATATTCTTGATTTCTGTTCTTGTATAGATA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0010723 positive regulation of transcription from RNA polymerase II promoter in response to iron biological_process
GO:0005634 nucleus cellular_component
GO:0016602 CCAAT-binding factor complex cellular_component
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function

KEGG:

id description
ko04612 Antigen processing and presentation
ko05152 Tuberculosis
ko05017 Spinocerebellar ataxia
ko03000 Transcription factors

ZFIN:

id description
ZDB-GENE-010501-1 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Predicted to be part of CCAAT-binding activity factor complex. Orthologous to human NFYA (nuclear transcription factor Y subunit alpha).

Ensembl:

ensembl_id ENSDART00000140397

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008839 lncRNA downstream 8308 36242059 ~ 36246756 (-) True XLOC_004264
TCONS_00008124 lncRNA downstream 513620 35725245 ~ 35741444 (-) False XLOC_004257
TCONS_00008123 lncRNA downstream 513620 35725245 ~ 35741444 (-) True XLOC_004257
TCONS_00008837 lncRNA downstream 513623 35664551 ~ 35741441 (-) False XLOC_004257
TCONS_00008152 lncRNA upstream 26922 36290808 ~ 36291682 (-) True XLOC_004266
TCONS_00008841 lncRNA upstream 220506 36484392 ~ 36687156 (-) False XLOC_004269
TCONS_00008840 lncRNA upstream 220506 36484392 ~ 36687156 (-) False XLOC_004269
TCONS_00008161 lncRNA upstream 220506 36484392 ~ 36687161 (-) False XLOC_004269
TCONS_00008842 lncRNA upstream 305038 36568924 ~ 36569266 (-) True XLOC_004270
TCONS_00008144 mRNA downstream 24901 36215698 ~ 36230163 (-) False XLOC_004263
TCONS_00008145 mRNA downstream 24918 36215780 ~ 36230146 (-) True XLOC_004263
TCONS_00008143 mRNA downstream 98093 36048886 ~ 36156971 (-) True XLOC_004262
TCONS_00008140 mRNA downstream 98129 36042269 ~ 36156935 (-) False XLOC_004262
TCONS_00008150 mRNA upstream 16637 36280523 ~ 36341189 (-) False XLOC_004266
TCONS_00008151 mRNA upstream 17724 36281610 ~ 36341028 (-) False XLOC_004266
TCONS_00008153 mRNA upstream 79111 36342997 ~ 36350993 (-) False XLOC_004267
TCONS_00008154 mRNA upstream 79389 36343275 ~ 36350421 (-) False XLOC_004267
TCONS_00008155 mRNA upstream 81650 36345536 ~ 36350876 (-) True XLOC_004267
TCONS_00008119 other downstream 1029925 35225022 ~ 35225139 (-) True XLOC_004254
TCONS_00008105 other downstream 1788551 34466395 ~ 34466513 (-) True XLOC_004247
TCONS_00008102 other downstream 1899402 34355544 ~ 34355662 (-) True XLOC_004245
TCONS_00008088 other downstream 2288792 33966158 ~ 33966272 (-) True XLOC_004234
TCONS_00008078 other downstream 2883697 33371251 ~ 33371367 (-) True XLOC_004227
TCONS_00008174 other upstream 1035485 37299371 ~ 37299485 (-) True XLOC_004279
TCONS_00008194 other upstream 1911185 38175071 ~ 38175150 (-) True XLOC_004294
TCONS_00008207 other upstream 2684101 38947987 ~ 38949751 (-) True XLOC_004305
TCONS_00008210 other upstream 2825989 39089875 ~ 39089991 (-) True XLOC_004308
TCONS_00008222 other upstream 3918795 40182681 ~ 40182796 (-) True XLOC_004319

Expression Profile

//