RNA id: TCONS_00008249


Basic Information

Item Value
RNA id TCONS_00008249
length 394
RNA type mRNA
GC content 0.48
exon number 2
gene id XLOC_004337
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 41216191 ~ 41222971 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TATCTTTGTCTCGACAGCATCTTTCCTGCTCAAGAAGTACCACGGCGGGCATGTGGTCATCAGGCTGGCTTTAGGAGGTGCCACTAACAGACCTTTCTACCGTATTGTAGCAGCTTATAATAAACGGGCAAGAGATGGCAAATACCTTGAGCAGGTGGGCTCATACGACCCTCTCCCAAACGTACACAACGAAAAACTCGTCGCATTCAATTATGAAAGAATCAAGCATTGGATTGCATGCGGAGCCCATACGACAAAACCAGTGGCCAAACTTCTGGGATTGGCTGGATTTTTCCCTTTGCATCCGATGACAATAACAGAAGCGGAGCGGAGACAGAAAGCAGCTTCAAGAGAAGAAGTTAAAACAGACAGTCAGGAGGAGGTGGAGCAGTGA

Function

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005763 mitochondrial small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03010 Ribosome
ko03011 Ribosome
ko03029 Mitochondrial biogenesis

ZFIN:

id description
ZDB-GENE-041010-123 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of mitochondrial small ribosomal subunit. Is expressed in alar plate midbrain region; eye; immature eye; midbrain; and optic tectum. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 2. Orthologous to human MRPS16 (mitochondrial ribosomal protein S16).

Ensembl:

ensembl_id ENSDART00000192895

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008247 lncRNA downstream 15495 41192329 ~ 41201272 (-) True XLOC_004336
TCONS_00008490 lncRNA downstream 266949 40948889 ~ 40949818 (-) True XLOC_004333
TCONS_00008242 lncRNA downstream 321522 40893766 ~ 40895245 (-) True XLOC_004332
TCONS_00008241 lncRNA downstream 356297 40858654 ~ 40860470 (-) True XLOC_004331
TCONS_00008240 lncRNA downstream 455449 40760718 ~ 40761318 (-) True XLOC_004330
TCONS_00008863 lncRNA upstream 62497 41283291 ~ 41316649 (-) True XLOC_004338
TCONS_00008864 lncRNA upstream 478781 41699575 ~ 41710057 (-) True XLOC_004340
TCONS_00008491 lncRNA upstream 754783 41975577 ~ 41999417 (-) True XLOC_004345
TCONS_00008865 lncRNA upstream 783369 42004163 ~ 42026598 (-) True XLOC_004347
TCONS_00008866 lncRNA upstream 795960 42016754 ~ 42019865 (-) True XLOC_004348
TCONS_00008245 mRNA downstream 84471 41110397 ~ 41132296 (-) False XLOC_004335
TCONS_00008246 mRNA downstream 86528 41115802 ~ 41130239 (-) True XLOC_004335
TCONS_00008243 mRNA downstream 132409 41078191 ~ 41084358 (-) False XLOC_004334
TCONS_00008239 mRNA downstream 474260 40731602 ~ 40742507 (-) True XLOC_004329
TCONS_00008238 mRNA downstream 474343 40731602 ~ 40742424 (-) False XLOC_004329
TCONS_00008251 mRNA upstream 491597 41712391 ~ 41779281 (-) True XLOC_004341
TCONS_00008252 mRNA upstream 561889 41782683 ~ 41786522 (-) True XLOC_004342
TCONS_00008253 mRNA upstream 625265 41846059 ~ 41853874 (-) True XLOC_004343
TCONS_00008254 mRNA upstream 745323 41966117 ~ 41966854 (-) True XLOC_004344
TCONS_00008255 mRNA upstream 773493 41994287 ~ 41996957 (-) True XLOC_004346
TCONS_00008244 other downstream 132404 41078191 ~ 41084363 (-) True XLOC_004334
TCONS_00008236 other downstream 520631 40678213 ~ 40696136 (-) True XLOC_004327
TCONS_00008222 other downstream 1033971 40182681 ~ 40182796 (-) True XLOC_004319
TCONS_00008210 other downstream 2126776 39089875 ~ 39089991 (-) True XLOC_004308
TCONS_00008207 other downstream 2267016 38947987 ~ 38949751 (-) True XLOC_004305
TCONS_00008250 other upstream 154217 41375011 ~ 41375126 (-) True XLOC_004339
TCONS_00008295 other upstream 2902533 44123327 ~ 44123458 (-) True XLOC_004381
TCONS_00008303 other upstream 3116363 44337157 ~ 44339220 (-) True XLOC_004385
TCONS_00008317 other upstream 3386057 44606851 ~ 44613734 (-) False XLOC_004396
TCONS_00008372 other upstream 4210739 45431533 ~ 45435014 (-) False XLOC_004416

Expression Profile

//