RNA id: TCONS_00009054


Basic Information

Item Value
RNA id TCONS_00009054
length 525
RNA type mRNA
GC content 0.47
exon number 6
gene id XLOC_004552
representative True

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 10115964 ~ 10125777 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAAAATGGAGGACGTGTCTCTGTCCAGTATGGACAACAGTAAGATGGAGGGCTTTGCTCAAGAGATCCTGTCTGACCTGGTGGAGGACGCCTGTTTGGGTCTTTGTTTTGAAGTTCACAGGGCTGTCAAACAGGGATACTTTTTCCTGGACGATACAGACCAAGAGAGTATGAAAGACTTTGAAATTGTGGACCAGCCTGGAGTAGACATTTTTGGGCAAGTGTACAACCAGTGGAAAAACAAAGAGTGCGTTTGTCCCAACTGCAGCCGCAGCATCGCTGCCTCACGATTTGCTCCTCATCTGGAGAAATGCCTTGGCATGGGCCGCAACAGCAGTCGTATTGCCAACCGCAGAATTGCGAGTGGCAACAACACGAACAAATCGGAGAGCGATCAGGAGGACAATGATGATGTCAACGACAATGACTGGTCTTATGGGGCAGAAAAGAAAGCCAAGAAGAGAAAGTCAGATAAGAATCCAAATTCACCAAGAAGATCCAAATCCATGAAACATAAAAATGGT

Function

GO:

id name namespace
GO:0006325 chromatin organization biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0016578 histone deubiquitination biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0071819 DUBm complex cellular_component
GO:0000124 SAGA complex cellular_component
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003713 transcription coactivator activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-7685 Predicted to enable transcription coactivator activity. Predicted to be involved in histone deubiquitination; positive regulation of transcription, DNA-templated; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within chromatin organization. Predicted to be located in nucleus. Predicted to be part of DUBm complex and SAGA complex. Orthologous to human ATXN7L3 (ataxin 7 like 3).

Ensembl:

ensembl_id ENSDART00000189630

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00010897 lncRNA upstream 166423 9941133 ~ 9950489 (+) True XLOC_004550
TCONS_00010896 lncRNA upstream 304426 9797037 ~ 9812486 (+) True XLOC_004546
TCONS_00010895 lncRNA upstream 339583 9769918 ~ 9777329 (+) False XLOC_004545
TCONS_00010894 lncRNA upstream 339583 9769918 ~ 9777329 (+) True XLOC_004545
TCONS_00010893 lncRNA upstream 413021 9703175 ~ 9703891 (+) False XLOC_004545
TCONS_00009058 lncRNA downstream 41003 10163641 ~ 10167477 (+) True XLOC_004554
TCONS_00009063 lncRNA downstream 325604 10448242 ~ 10448831 (+) True XLOC_004558
TCONS_00009075 lncRNA downstream 1236563 11359201 ~ 11363061 (+) True XLOC_004564
TCONS_00010724 lncRNA downstream 2292618 12415256 ~ 12415835 (+) True XLOC_004568
TCONS_00009084 lncRNA downstream 2971678 13094316 ~ 13095670 (+) True XLOC_004570
TCONS_00009051 mRNA upstream 16408 10053852 ~ 10100504 (+) False XLOC_004551
TCONS_00009052 mRNA upstream 47748 10062953 ~ 10069164 (+) True XLOC_004551
TCONS_00009050 mRNA upstream 232586 9880493 ~ 9884326 (+) True XLOC_004549
TCONS_00009049 mRNA upstream 240836 9849476 ~ 9876076 (+) True XLOC_004548
TCONS_00009047 mRNA upstream 276093 9817440 ~ 9840819 (+) False XLOC_004547
TCONS_00009056 mRNA downstream 11728 10134366 ~ 10160941 (+) True XLOC_004553
TCONS_00009057 mRNA downstream 40947 10163585 ~ 10175487 (+) False XLOC_004554
TCONS_00009059 mRNA downstream 56814 10179452 ~ 10193551 (+) True XLOC_004555
TCONS_00009061 mRNA downstream 321147 10443785 ~ 10447178 (+) True XLOC_004557
TCONS_00009062 mRNA downstream 325588 10448226 ~ 10462503 (+) False XLOC_004558
TCONS_00009019 other upstream 2384262 7732534 ~ 7732650 (+) True XLOC_004523
TCONS_00009018 other upstream 2555710 7561065 ~ 7561202 (+) True XLOC_004522
TCONS_00009013 other upstream 2696764 7420032 ~ 7420148 (+) True XLOC_004520
TCONS_00009009 other upstream 3408669 6708129 ~ 6708243 (+) True XLOC_004517
TCONS_00008977 other upstream 5026982 5089815 ~ 5089930 (+) True XLOC_004497
TCONS_00009055 other downstream 11728 10134366 ~ 10145811 (+) False XLOC_004553
TCONS_00009060 other downstream 88294 10210932 ~ 10211048 (+) True XLOC_004556
TCONS_00009076 other downstream 1520913 11643551 ~ 11643671 (+) True XLOC_004565
TCONS_00009079 other downstream 2490697 12613335 ~ 12613451 (+) True XLOC_004569
TCONS_00009094 other downstream 3161136 13283774 ~ 13292767 (+) True XLOC_004575

Expression Profile

//