RNA id: TU178099


Basic Information

Item Value
RNA id TU178099
length 310
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G141582
representative True

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 15217242 ~ 15217551 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

TAGCCACTCATCAAGGAAAGAGCACATTTTACTGGGTAATGATTCTATTGTACAACCAAATGTTGGAGAAGAGACTGAAGGCCTAGCTGAGTGGAAGAACTGTGAACAGGAGTACTTTTTATTTAGTTCAGATGACCACATGAGAGCAAACTAGATAGAAACGCTGGGTCTAAATGATGCACGTGGGCATTATAGGCAAATACATTTCCTGGTAGCCAGCTTAATTGCACCCGAGAGTATTTATTAAACCGTGAAAAGGTAGATACTGGGCTATACCCAGAATATGGCACTGTGCTCTAGTAAAGTGGGT

Function

GO:

id name namespace
GO:1902600 proton transmembrane transport biological_process
GO:0046034 ATP metabolic process biological_process
GO:1905039 carboxylic acid transmembrane transport biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006122 mitochondrial electron transport, ubiquinol to cytochrome c biological_process
GO:0022900 electron transport chain biological_process
GO:0098656 anion transmembrane transport biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:1903825 organic acid transmembrane transport biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:1990542 mitochondrial transmembrane transport biological_process
GO:0015718 monocarboxylic acid transport biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0006839 mitochondrial transport biological_process
GO:0006848 pyruvate transport biological_process
GO:0006850 mitochondrial pyruvate transmembrane transport biological_process
GO:1901475 pyruvate transmembrane transport biological_process
GO:0009055 electron transfer activity molecular_function
GO:0022857 transmembrane transporter activity molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko00190 Oxidative phosphorylation
ko04260 Cardiac muscle contraction
ko04723 Retrograde endocannabinoid signaling
ko04714 Thermogenesis
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05016 Huntington disease
ko04932 Non-alcoholic fatty liver disease

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU178085 lncRNA upstream 26897 15189983 ~ 15190345 (+) True G141574
TU178084 lncRNA upstream 30917 15186071 ~ 15186325 (+) True G141573
TU177863 lncRNA upstream 700732 14462167 ~ 14516510 (+) True G141405
TU177879 lncRNA upstream 708403 14500971 ~ 14508839 (+) True G141412
TU177856 lncRNA upstream 771887 14443857 ~ 14445355 (+) True G141401
TU178111 lncRNA downstream 35289 15252840 ~ 15254844 (+) True G141592
TU178262 lncRNA downstream 1273875 16491426 ~ 16500980 (+) False AMCG00003257
TU178408 lncRNA downstream 1581408 16798959 ~ 16801312 (+) True G141829
TU178473 lncRNA downstream 1814874 17032425 ~ 17035242 (+) True G141885
TU178576 lncRNA downstream 2300169 17517720 ~ 17517921 (+) True G141955
AMCG00003233 mRNA upstream 828 15204627 ~ 15216414 (+) True AMCG00003233
AMCG00003238 mRNA upstream 39027 15174130 ~ 15178215 (+) True AMCG00003238
AMCG00003234 mRNA upstream 49268 15163724 ~ 15167974 (+) True AMCG00003234
AMCG00003242 mRNA upstream 55704 15157133 ~ 15161538 (+) True AMCG00003242
AMCG00003229 mRNA upstream 70957 15135212 ~ 15146285 (+) True AMCG00003229
AMCG00003236 mRNA downstream 22950 15240501 ~ 15250404 (+) True AMCG00003236
AMCG00003237 mRNA downstream 48570 15266121 ~ 15267591 (+) True AMCG00003237
AMCG00003235 mRNA downstream 50670 15268221 ~ 15284542 (+) True AMCG00003235
AMCG00003243 mRNA downstream 71073 15288624 ~ 15301140 (+) True AMCG00003243
AMCG00003247 mRNA downstream 669565 15887116 ~ 15891866 (+) True AMCG00003247
TU177906 other upstream 611805 14601317 ~ 14605437 (+) False AMCG00003207
TU177803 other upstream 928500 14287807 ~ 14288742 (+) False AMCG00003195
TU177775 other upstream 1032599 14180780 ~ 14184643 (+) True G141331
TU177434 other upstream 2106608 13106456 ~ 13110634 (+) True AMCG00003158
TU177338 other upstream 2334244 12878685 ~ 12882998 (+) True AMCG00003141
TU178303 other downstream 1336460 16554011 ~ 16559206 (+) False AMCG00003256
TU178585 other downstream 2458728 17676279 ~ 17678522 (+) True G141962
TU178734 other downstream 3449216 18666767 ~ 18692204 (+) False G142078
TU178857 other downstream 4318142 19535693 ~ 19537091 (+) True G142172
TU178898 other downstream 4401330 19618881 ~ 19633073 (+) False AMCG00003323

Expression Profile