RNA id: AMCG00003710


Basic Information

Item Value
RNA id AMCG00003710
length 402
RNA type mRNA
GC content 0.63
exon number 1
gene id AMCG00003710
representative True

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 15590622 ~ 15591023 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGGCCTCTTCAAGGATGTACCTGGTTGCAAAATGTATGCTGCTCTCCCAGCTCCTGCTCCTGGTCGCCAAAAGCAGCCGGGCTCTACTGTGCCTGCCCTGCGACGAGTCCAAGTGCGAGGAGCCCCGCCACTGCCCCGGCGCCGTGGTGCCCGGCATCTGCGGCTGCTGCTCGGTGTGCGCCCGGCAGAGGAACGAGAGCTGCGGGGGAGTTTACGGACTGTACGGGACCTGCGACCGGGGGCTGCGGTGCGTCATACGACCCCCGTTGGACGGCGGCTCCATCACCCAGTACGAGGTCGGGCTGTGTGAAGGTACGGCGTCTGTGTCACCCGTGCAGAAAACAGTGCATTTCAACTTTAGCTGGTGCGTCTTTGTCTCCGTGCCGGTGCCTGGCTTTTAG

Function

GO:

id name namespace
GO:0001756 somitogenesis biological_process
GO:0048570 notochord morphogenesis biological_process
GO:0001558 regulation of cell growth biological_process
GO:0001568 blood vessel development biological_process
GO:0005576 extracellular region cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005520 insulin-like growth factor binding molecular_function
GO:0004867 serine-type endopeptidase inhibitor activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU3237 lncRNA downstream 80541 15509873 ~ 15510081 (-) True G2661
TU3213 lncRNA downstream 211641 15378758 ~ 15378981 (-) True G2637
TU3212 lncRNA downstream 212067 15378197 ~ 15378555 (-) True G2636
TU3188 lncRNA downstream 272412 15315396 ~ 15318210 (-) True G2615
TU3120 lncRNA downstream 474439 15115983 ~ 15116183 (-) True G2565
TU3261 lncRNA upstream 313464 15904487 ~ 15904821 (-) True G2682
TU3278 lncRNA upstream 438401 16029424 ~ 16030186 (-) True G2697
TU3281 lncRNA upstream 441664 16032687 ~ 16032922 (-) True G2699
TU3305 lncRNA upstream 488376 16079399 ~ 16084866 (-) True G2720
TU3310 lncRNA upstream 494092 16085115 ~ 16085995 (-) True G2722
AMCG00003709 mRNA downstream 71029 15515672 ~ 15519593 (-) True AMCG00003709
AMCG00003708 mRNA downstream 103421 15478494 ~ 15487201 (-) True AMCG00003708
AMCG00003707 mRNA downstream 134371 15419692 ~ 15456251 (-) True AMCG00003707
AMCG00003704 mRNA downstream 201701 15381456 ~ 15388921 (-) True AMCG00003704
AMCG00003697 mRNA downstream 419290 15161825 ~ 15171332 (-) True AMCG00003697
AMCG00003714 mRNA upstream 451705 16042728 ~ 16055653 (-) True AMCG00003714
AMCG00003717 mRNA upstream 504123 16095146 ~ 16116740 (-) True AMCG00003717
AMCG00003716 mRNA upstream 584748 16175771 ~ 16181167 (-) True AMCG00003716
AMCG00003722 mRNA upstream 621642 16212665 ~ 16222773 (-) True AMCG00003722
AMCG00003721 mRNA upstream 638634 16229657 ~ 16245607 (-) True AMCG00003721
TU3027 other downstream 779291 14810786 ~ 14811331 (-) True G2500
TU2876 other downstream 1577601 14009458 ~ 14013021 (-) True G2373
TU2747 other downstream 2479494 13104356 ~ 13111128 (-) False AMCG00003652
TU2704 other downstream 2555133 13034953 ~ 13035489 (-) True G2236
TU2508 other downstream 3512470 12076038 ~ 12078152 (-) False AMCG00003625
TU3879 other upstream 2351554 17942577 ~ 17944942 (-) True G3181
TU3909 other upstream 2555637 18146660 ~ 18152381 (-) True AMCG00003782
TU4265 other upstream 3833940 19424963 ~ 19425366 (-) True G3517
TU4274 other upstream 3852993 19444016 ~ 19444743 (-) True G3523
TU4276 other upstream 3852993 19444016 ~ 19506753 (-) False G3523

Expression Profile