RNA id: AMCG00007307



Basic Information


Item Value
RNA id AMCG00007307
length 378
RNA type mRNA
GC content 0.62
exon number 1
gene id AMCG00007307
representative False

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 10611196 ~ 10613104 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATGGCAAGCAGACACGTGGAGTCAGGAGGGTACCAGACCGTGGTGCCTGCTCACCTGCTGGCAGCTATGATGGAGGAATTTCCCCAGCATCTGCCTGTGCCCAAATCCCCGGCCAGGGGCAAGAGCCGGATGCGCCGCCCCCGCCAGTCCCGCTTCAAGACCCAACCAGTGACCTTCGCTGAGATCGCTGAAGTGGAGGAGGAAGGTGTTTCGGCGCTGGAGGAAGAGCGAGCCCGGAAGTCCTTCTTGCAGTCGCTGGAAAGCCTGAGACGCAGTACTCAGAACTTGCACAGCTCCAGCCACTGCCCCAAGGGCTGGGTGGCTACGTCCGCCATGCAGGGCAGTGTGGACTCCAGCGACTCAGACTCCACGCAGTAG

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU28342 lncRNA upstream 289675 10320469 ~ 10321858 (+) True G22596
TU28244 lncRNA upstream 370125 10239589 ~ 10241408 (+) True G22528
TU28245 lncRNA upstream 370125 10239589 ~ 10241408 (+) False G22528
TU28246 lncRNA upstream 371668 10152489 ~ 10239865 (+) False G22528
TU28168 lncRNA upstream 669645 9936920 ~ 9941888 (+) False AMCG00007278
TU28422 lncRNA downstream 14764 10626674 ~ 10685068 (+) True G22652
TU28495 lncRNA downstream 499433 11111343 ~ 11111723 (+) True G22712
TU28504 lncRNA downstream 617915 11229825 ~ 11230393 (+) True G22720
TU28516 lncRNA downstream 900243 11512153 ~ 11522358 (+) True G22730
TU28528 lncRNA downstream 929073 11540983 ~ 11541524 (+) True G22738
AMCG00007304 mRNA upstream 2518 10577246 ~ 10609015 (+) True AMCG00007304
AMCG00007303 mRNA upstream 34369 10534157 ~ 10577164 (+) True AMCG00007303
AMCG00007300 mRNA upstream 190622 10394165 ~ 10420911 (+) True AMCG00007300
AMCG00007301 mRNA upstream 228250 10373970 ~ 10383283 (+) True AMCG00007301
AMCG00007292 mRNA upstream 253928 10343702 ~ 10357605 (+) True AMCG00007292
AMCG00007308 mRNA downstream 16440 10628350 ~ 10654989 (+) True AMCG00007308
AMCG00007305 mRNA downstream 48271 10660181 ~ 10667295 (+) True AMCG00007305
AMCG00007306 mRNA downstream 127135 10739045 ~ 10743675 (+) True AMCG00007306
AMCG00007310 mRNA downstream 146924 10758834 ~ 10777707 (+) True AMCG00007310
AMCG00007311 mRNA downstream 976724 11588634 ~ 11603718 (+) True AMCG00007311
TU28037 other upstream 1111805 9436524 ~ 9499728 (+) True G22372
TU27900 other upstream 1900222 8704657 ~ 8711311 (+) True AMCG00007253
TU27825 other upstream 2215291 8367436 ~ 8396242 (+) True AMCG00007243
TU27445 other upstream 3232587 7374323 ~ 7378946 (+) True G21891
TU26964 other upstream 5031239 5565941 ~ 5580294 (+) False AMCG00007148
TU28829 other downstream 3866763 14478673 ~ 14489692 (+) True AMCG00007337
TU28988 other downstream 4674587 15286497 ~ 15287960 (+) False AMCG00007352
TU29675 other downstream 7586858 18198768 ~ 18201960 (+) True AMCG00007417
TU29676 other downstream 7595168 18207078 ~ 18208308 (+) True G23698
TU29705 other downstream 7678198 18290108 ~ 18292338 (+) True G23724

Expression Profile


AMCG00007307 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

AMCG00007307 Expression in each Bioproject

Bar chart with 1 bar.
AMCG00007307 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.