RNA id: AMCG00007322



Basic Information


Item Value
RNA id AMCG00007322
length 387
RNA type mRNA
GC content 0.48
exon number 1
gene id AMCG00007322
representative True

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 13646627 ~ 13647013 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATGAGACTATGCTTCCTGGTCAACCACATTCACTCTGGCTCTCGGAAGGGGAGTAGTGATCCTCCTCCAACCGTCATTGTGGCCAACAAGAAGGACCTCCAGTATGATAGGATGGTGACTACTGAGGACGGAGAGTCACTGTCCAAGGGGCTCAAACTTCCCTTCTTTGAAATCTCAGCCAGGGACAGCTGGGAGGAGACAGCAACTGTCTTCCACACACTTTACGGGGAAATGATGAAACAGCTTACCTCTTCACCAACATCTTTCAGGAAGAGAACTGTTTCCAAGTTGATGGAGAAGATCCCCAAAATCAATTCCAACTCCACACTTGGATCAACAGGCAGAAGCTTCAGTTTTGGCTCCTTCAGGGACTTCTTATCTGATTGA

Function


GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:0016020 membrane cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28695 lncRNA upstream 9003 13637424 ~ 13637624 (+) True G22888
TU28694 lncRNA upstream 14667 13631546 ~ 13631960 (+) True G22887
TU28640 lncRNA upstream 154293 13483495 ~ 13492334 (+) True G22844
TU28634 lncRNA upstream 292171 13353613 ~ 13354456 (+) True G22839
TU28632 lncRNA upstream 294708 13351626 ~ 13351919 (+) True G22837
TU28701 lncRNA downstream 29944 13676957 ~ 13677701 (+) True G22893
TU28748 lncRNA downstream 298625 13945638 ~ 13946065 (+) True G22930
TU28750 lncRNA downstream 375078 14022091 ~ 14022317 (+) True G22932
TU28753 lncRNA downstream 393779 14040792 ~ 14041060 (+) True G22935
TU28761 lncRNA downstream 417937 14064950 ~ 14065208 (+) True G22940
AMCG00007321 mRNA upstream 21820 13623144 ~ 13624807 (+) True AMCG00007321
AMCG00007317 mRNA upstream 95506 13541756 ~ 13551121 (+) True AMCG00007317
AMCG00007311 mRNA upstream 2042909 11588634 ~ 11603718 (+) True AMCG00007311
AMCG00007310 mRNA upstream 2868920 10758834 ~ 10777707 (+) True AMCG00007310
AMCG00007306 mRNA upstream 2902952 10739045 ~ 10743675 (+) True AMCG00007306
AMCG00007328 mRNA downstream 328292 13975305 ~ 13981853 (+) True AMCG00007328
AMCG00007327 mRNA downstream 402380 14049393 ~ 14064082 (+) True AMCG00007327
AMCG00007329 mRNA downstream 511171 14158184 ~ 14185574 (+) True AMCG00007329
AMCG00007332 mRNA downstream 718695 14365708 ~ 14383919 (+) True AMCG00007332
AMCG00007335 mRNA downstream 792313 14439326 ~ 14473693 (+) True AMCG00007335
TU28420 other upstream 3033523 10611196 ~ 10613104 (+) True AMCG00007307
TU28037 other upstream 4146899 9436524 ~ 9499728 (+) True G22372
TU27900 other upstream 4935316 8704657 ~ 8711311 (+) True AMCG00007253
TU27825 other upstream 5250385 8367436 ~ 8396242 (+) True AMCG00007243
TU27445 other upstream 6267681 7374323 ~ 7378946 (+) True G21891
TU28829 other downstream 831660 14478673 ~ 14489692 (+) True AMCG00007337
TU28988 other downstream 1639484 15286497 ~ 15287960 (+) False AMCG00007352
TU29675 other downstream 4551755 18198768 ~ 18201960 (+) True AMCG00007417
TU29676 other downstream 4560065 18207078 ~ 18208308 (+) True G23698
TU29705 other downstream 4643095 18290108 ~ 18292338 (+) True G23724

Expression Profile


AMCG00007322 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

AMCG00007322 Expression in each Bioproject

Bar chart with 4 bars.
AMCG00007322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 16.
End of interactive chart.