RNA id: TU28551



Basic Information


Item Value
RNA id TU28551
length 229
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G22760
representative True

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 11812865 ~ 11813093 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ccctaacattctgtttgccttttttattgcttccccacattgtttggatggagaaagtgaggagtccacatagactcctaggtctttctcatctagttctattcctcccatagtgtaattatagtggacatttttgttacctgcatgtaataccttgcacttgtccacattgaatttcatctgccaggtgtcagcccacaactgaatattatctaagtccctttgaata

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28547 lncRNA upstream 89119 11723492 ~ 11723746 (+) True G22756
TU28532 lncRNA upstream 239003 11570952 ~ 11573862 (+) True G22741
TU28528 lncRNA upstream 271341 11540983 ~ 11541524 (+) True G22738
TU28516 lncRNA upstream 290507 11512153 ~ 11522358 (+) True G22730
TU28504 lncRNA upstream 582472 11229825 ~ 11230393 (+) True G22720
TU28560 lncRNA downstream 52343 11865436 ~ 11866024 (+) True G22769
TU28561 lncRNA downstream 53070 11866163 ~ 11866484 (+) True G22770
TU28564 lncRNA downstream 64412 11877505 ~ 11877862 (+) True G22773
TU28566 lncRNA downstream 66307 11879400 ~ 11879606 (+) True G22775
TU28572 lncRNA downstream 84450 11897543 ~ 11898137 (+) True G22781
AMCG00007311 mRNA upstream 209147 11588634 ~ 11603718 (+) True AMCG00007311
AMCG00007310 mRNA upstream 1035158 10758834 ~ 10777707 (+) True AMCG00007310
AMCG00007306 mRNA upstream 1069190 10739045 ~ 10743675 (+) True AMCG00007306
AMCG00007305 mRNA upstream 1145570 10660181 ~ 10667295 (+) True AMCG00007305
AMCG00007308 mRNA upstream 1157876 10628350 ~ 10654989 (+) True AMCG00007308
AMCG00007317 mRNA downstream 1728663 13541756 ~ 13551121 (+) True AMCG00007317
AMCG00007321 mRNA downstream 1810051 13623144 ~ 13624807 (+) True AMCG00007321
AMCG00007322 mRNA downstream 1833534 13646627 ~ 13647013 (+) True AMCG00007322
AMCG00007328 mRNA downstream 2162212 13975305 ~ 13981853 (+) True AMCG00007328
AMCG00007327 mRNA downstream 2236300 14049393 ~ 14064082 (+) True AMCG00007327
TU28420 other upstream 1199761 10611196 ~ 10613104 (+) True AMCG00007307
TU28037 other upstream 2313137 9436524 ~ 9499728 (+) True G22372
TU27900 other upstream 3101554 8704657 ~ 8711311 (+) True AMCG00007253
TU27825 other upstream 3416623 8367436 ~ 8396242 (+) True AMCG00007243
TU27445 other upstream 4433919 7374323 ~ 7378946 (+) True G21891
TU28829 other downstream 2665580 14478673 ~ 14489692 (+) True AMCG00007337
TU28988 other downstream 3473404 15286497 ~ 15287960 (+) False AMCG00007352
TU29675 other downstream 6385675 18198768 ~ 18201960 (+) True AMCG00007417
TU29676 other downstream 6393985 18207078 ~ 18208308 (+) True G23698
TU29705 other downstream 6477015 18290108 ~ 18292338 (+) True G23724

Expression Profile


TU28551 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU28551 Expression in each Bioproject

Bar chart with 6 bars.
TU28551 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.